Incidental Mutation 'R1417:Syt11'
ID159845
Institutional Source Beutler Lab
Gene Symbol Syt11
Ensembl Gene ENSMUSG00000068923
Gene Namesynaptotagmin XI
Synonyms6530420C11Rik
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88744700-88775164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88761982 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 201 (I201N)
Ref Sequence ENSEMBL: ENSMUSP00000103129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090945] [ENSMUST00000107505]
Predicted Effect probably damaging
Transcript: ENSMUST00000090945
AA Change: I201N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088464
Gene: ENSMUSG00000068923
AA Change: I201N

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
C2 172 276 2.36e-17 SMART
C2 306 422 1.37e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107505
AA Change: I201N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103129
Gene: ENSMUSG00000068923
AA Change: I201N

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
C2 172 276 2.36e-17 SMART
C2 306 422 1.37e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000183267
AA Change: I134N
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that are known calcium sensors and mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. The encoded protein is also a substrate for ubiquitin-E3-ligase parkin. The gene has previously been referred to as synaptotagmin XII but has been renamed synaptotagmin XI to be consistent with mouse and rat official nomenclature. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutation of this gene results in no obvious abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Syt11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Syt11 APN 3 88762216 missense probably benign 0.01
IGL01404:Syt11 APN 3 88762216 missense probably benign 0.01
IGL03031:Syt11 APN 3 88748841 start codon destroyed probably null 0.06
R0041:Syt11 UTSW 3 88747903 missense probably damaging 1.00
R0326:Syt11 UTSW 3 88762548 missense possibly damaging 0.71
R0569:Syt11 UTSW 3 88747923 missense probably benign 0.02
R0613:Syt11 UTSW 3 88762469 missense probably damaging 1.00
R1209:Syt11 UTSW 3 88747840 missense probably damaging 1.00
R1530:Syt11 UTSW 3 88762367 missense probably damaging 1.00
R1544:Syt11 UTSW 3 88748803 missense probably benign 0.00
R1727:Syt11 UTSW 3 88761952 missense possibly damaging 0.92
R4952:Syt11 UTSW 3 88762283 missense possibly damaging 0.85
R5097:Syt11 UTSW 3 88747924 missense probably benign 0.01
R5162:Syt11 UTSW 3 88747842 missense probably damaging 1.00
R6024:Syt11 UTSW 3 88762109 missense probably benign
R6875:Syt11 UTSW 3 88762155 missense possibly damaging 0.84
R7013:Syt11 UTSW 3 88747989 missense possibly damaging 0.82
R7761:Syt11 UTSW 3 88762471 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGAGAATCGATCAAAGCTGAGCACC -3'
(R):5'- AATAAACGCGGAGTCTGGCCTG -3'

Sequencing Primer
(F):5'- GCTGAGCACCAGGAAATGC -3'
(R):5'- GCATCTTGTATGGACCAGTTAC -3'
Posted On2014-03-14