Incidental Mutation 'R1417:Zkscan16'
ID159847
Institutional Source Beutler Lab
Gene Symbol Zkscan16
Ensembl Gene ENSMUSG00000038630
Gene Namezinc finger with KRAB and SCAN domains 16
SynonymsZfp483
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58943628-58958355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58952377 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 225 (V225A)
Ref Sequence ENSEMBL: ENSMUSP00000103178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107554]
Predicted Effect probably benign
Transcript: ENSMUST00000107554
AA Change: V225A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103178
Gene: ENSMUSG00000038630
AA Change: V225A

DomainStartEndE-ValueType
SCAN 44 153 1.9e-42 SMART
KRAB 170 230 1.66e-20 SMART
internal_repeat_1 281 452 7.49e-5 PROSPERO
ZnF_C2H2 483 505 4.79e-3 SMART
ZnF_C2H2 511 533 2.75e-3 SMART
ZnF_C2H2 539 561 1.6e-4 SMART
ZnF_C2H2 567 589 5.99e-4 SMART
ZnF_C2H2 595 617 1.99e0 SMART
ZnF_C2H2 623 645 5.14e-3 SMART
ZnF_C2H2 651 673 2.65e-5 SMART
ZnF_C2H2 679 701 1.82e-3 SMART
ZnF_C2H2 706 725 4.74e1 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Other mutations in Zkscan16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Zkscan16 APN 4 58957709 missense possibly damaging 0.86
IGL01296:Zkscan16 APN 4 58956690 missense possibly damaging 0.53
IGL01330:Zkscan16 APN 4 58956483 missense possibly damaging 0.85
IGL02143:Zkscan16 APN 4 58956911 missense probably damaging 1.00
IGL02901:Zkscan16 APN 4 58946283 missense probably damaging 0.98
IGL03399:Zkscan16 APN 4 58956915 missense probably benign 0.33
R0271:Zkscan16 UTSW 4 58952391 missense probably benign 0.33
R0317:Zkscan16 UTSW 4 58957602 missense possibly damaging 0.86
R0542:Zkscan16 UTSW 4 58956597 missense possibly damaging 0.53
R1674:Zkscan16 UTSW 4 58948918 missense possibly damaging 0.96
R2014:Zkscan16 UTSW 4 58956525 missense possibly damaging 0.96
R2246:Zkscan16 UTSW 4 58957329 missense probably benign 0.09
R2352:Zkscan16 UTSW 4 58951869 missense possibly damaging 0.71
R2851:Zkscan16 UTSW 4 58957364 missense possibly damaging 0.71
R2852:Zkscan16 UTSW 4 58957364 missense possibly damaging 0.71
R3896:Zkscan16 UTSW 4 58946125 start gained probably benign
R4488:Zkscan16 UTSW 4 58957431 missense possibly damaging 0.89
R4631:Zkscan16 UTSW 4 58951918 missense probably damaging 0.98
R4825:Zkscan16 UTSW 4 58957809 missense possibly damaging 0.73
R4912:Zkscan16 UTSW 4 58946506 missense possibly damaging 0.85
R5014:Zkscan16 UTSW 4 58951892 missense probably damaging 0.97
R5411:Zkscan16 UTSW 4 58956745 frame shift probably null
R5642:Zkscan16 UTSW 4 58957748 missense probably benign 0.11
R5809:Zkscan16 UTSW 4 58946481 missense probably damaging 0.98
R6089:Zkscan16 UTSW 4 58948889 missense possibly damaging 0.85
R6152:Zkscan16 UTSW 4 58946260 missense possibly damaging 0.85
R6469:Zkscan16 UTSW 4 58956483 missense probably damaging 0.98
R7662:Zkscan16 UTSW 4 58957679 nonsense probably null
R7790:Zkscan16 UTSW 4 58951843 nonsense probably null
X0020:Zkscan16 UTSW 4 58956747 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TATCTTCTGGGCATCTGGGACCTG -3'
(R):5'- GGCGAGGCTCTTTCCTAATCCATC -3'

Sequencing Primer
(F):5'- ATCTGGGACCTGACATGACTG -3'
(R):5'- GCTCTTTCCTAATCCATCAACCG -3'
Posted On2014-03-14