Incidental Mutation 'R1417:Atp6v1b1'
List |< first << previous [record 2 of 36] next >> last >|
ID159851
Institutional Source Beutler Lab
Gene Symbol Atp6v1b1
Ensembl Gene ENSMUSG00000006269
Gene NameATPase, H+ transporting, lysosomal V1 subunit B1
SynonymsAtp6b1, Vpp-3, D630039P21Rik, lysosomal 56/58kDa, Vpp3, D630030L16Rik
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83742990-83758855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83753880 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 196 (S196P)
Ref Sequence ENSEMBL: ENSMUSP00000145710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006431] [ENSMUST00000205763] [ENSMUST00000206911]
Predicted Effect probably damaging
Transcript: ENSMUST00000006431
AA Change: S187P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006431
Gene: ENSMUSG00000006269
AA Change: S187P

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 44 110 1.9e-14 PFAM
Pfam:ATP-synt_ab 167 393 9.4e-68 PFAM
Pfam:ATP-synt_ab_C 410 508 6.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205763
AA Change: S196P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206652
Predicted Effect probably benign
Transcript: ENSMUST00000206911
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain B subunit isoforms and is found in the kidney. Mutations in this gene cause distal renal tubular acidosis associated with sensorineural deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation show impaired urinary acidification with a more severe metabolic acidosis and inappropriately alkaline urine after oral acid challenge. However, contrary to expectation, neither hearing nor inner ear morphology areimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Atp6v1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Atp6v1b1 APN 6 83749915 splice site probably benign
IGL02005:Atp6v1b1 APN 6 83753914 unclassified probably benign
IGL02085:Atp6v1b1 APN 6 83753915 unclassified probably benign
IGL02100:Atp6v1b1 APN 6 83758444 missense probably damaging 1.00
IGL02267:Atp6v1b1 APN 6 83756909 missense probably benign 0.44
IGL02507:Atp6v1b1 APN 6 83756855 missense possibly damaging 0.95
IGL02563:Atp6v1b1 APN 6 83755451 missense probably benign 0.14
IGL03144:Atp6v1b1 APN 6 83758351 missense probably benign 0.02
R0391:Atp6v1b1 UTSW 6 83756921 missense possibly damaging 0.93
R0420:Atp6v1b1 UTSW 6 83752844 unclassified probably benign
R0458:Atp6v1b1 UTSW 6 83752408 missense probably damaging 1.00
R0561:Atp6v1b1 UTSW 6 83753811 missense probably damaging 1.00
R0947:Atp6v1b1 UTSW 6 83753832 missense probably damaging 1.00
R1241:Atp6v1b1 UTSW 6 83756544 unclassified probably benign
R1447:Atp6v1b1 UTSW 6 83757942 missense possibly damaging 0.46
R1710:Atp6v1b1 UTSW 6 83758390 missense probably benign
R1722:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.68
R1862:Atp6v1b1 UTSW 6 83749852 critical splice acceptor site probably null
R2086:Atp6v1b1 UTSW 6 83757852 missense probably benign 0.10
R3433:Atp6v1b1 UTSW 6 83743092 missense possibly damaging 0.81
R4193:Atp6v1b1 UTSW 6 83743103 missense probably benign 0.01
R4606:Atp6v1b1 UTSW 6 83752461 missense probably damaging 1.00
R5901:Atp6v1b1 UTSW 6 83758357 missense possibly damaging 0.87
R6156:Atp6v1b1 UTSW 6 83758133 missense probably damaging 1.00
R6187:Atp6v1b1 UTSW 6 83752395 missense probably damaging 1.00
R6717:Atp6v1b1 UTSW 6 83753650 intron probably null
R6727:Atp6v1b1 UTSW 6 83751875 unclassified probably benign
R6952:Atp6v1b1 UTSW 6 83754810 missense probably damaging 1.00
R7753:Atp6v1b1 UTSW 6 83752458 missense probably benign 0.02
R7852:Atp6v1b1 UTSW 6 83752470 missense possibly damaging 0.47
R7935:Atp6v1b1 UTSW 6 83752470 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGCACACAGAGCACAGTTCCATTG -3'
(R):5'- AGTGTCTGTTATGCAGCCCTGACC -3'

Sequencing Primer
(F):5'- CCATTGTTACAGAAGCTGCTG -3'
(R):5'- CAGCCCTGACCTTGAGTG -3'
Posted On2014-03-14