Incidental Mutation 'R1417:Ipo8'
ID159852
Institutional Source Beutler Lab
Gene Symbol Ipo8
Ensembl Gene ENSMUSG00000040029
Gene Nameimportin 8
SynonymsOM-1, Om1, C130009K11Rik, Ranbp8, 6230418K12Rik
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location148770683-148831467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 148818052 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 132 (D132N)
Ref Sequence ENSEMBL: ENSMUSP00000046759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048418] [ENSMUST00000145960] [ENSMUST00000204936]
Predicted Effect probably benign
Transcript: ENSMUST00000048418
AA Change: D132N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000046759
Gene: ENSMUSG00000040029
AA Change: D132N

DomainStartEndE-ValueType
IBN_N 22 102 1.59e-13 SMART
Pfam:Cse1 166 470 6.6e-11 PFAM
low complexity region 895 908 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145743
Predicted Effect probably benign
Transcript: ENSMUST00000145960
AA Change: D132N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117365
Gene: ENSMUSG00000040029
AA Change: D132N

DomainStartEndE-ValueType
IBN_N 22 102 1.59e-13 SMART
low complexity region 176 190 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205196
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. This protein binds to the nuclear pore complex and, along with RanGTP and RANBP1, inhibits the GAP stimulation of the Ran GTPase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Ipo8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ipo8 APN 6 148782786 missense possibly damaging 0.77
IGL01012:Ipo8 APN 6 148789063 splice site probably benign
IGL01124:Ipo8 APN 6 148777376 missense probably benign
IGL01978:Ipo8 APN 6 148777289 missense probably benign 0.25
IGL02111:Ipo8 APN 6 148799780 missense probably damaging 1.00
IGL02193:Ipo8 APN 6 148777284 missense probably damaging 0.96
IGL02589:Ipo8 APN 6 148809907 missense probably damaging 0.98
IGL02690:Ipo8 APN 6 148777363 missense probably benign
IGL02724:Ipo8 APN 6 148791481 nonsense probably null
IGL02935:Ipo8 APN 6 148789841 missense probably benign 0.03
IGL03027:Ipo8 APN 6 148777239 missense probably benign 0.01
IGL03065:Ipo8 APN 6 148784707 missense probably benign 0.44
IGL03338:Ipo8 APN 6 148800257 missense probably benign 0.01
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0088:Ipo8 UTSW 6 148801936 missense probably benign 0.27
R0373:Ipo8 UTSW 6 148775042 missense probably benign 0.00
R0539:Ipo8 UTSW 6 148818108 missense probably benign 0.00
R0565:Ipo8 UTSW 6 148786723 missense probably damaging 1.00
R0660:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0664:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0791:Ipo8 UTSW 6 148821727 missense possibly damaging 0.94
R0989:Ipo8 UTSW 6 148796682 missense probably benign 0.38
R1416:Ipo8 UTSW 6 148789093 missense probably benign
R1590:Ipo8 UTSW 6 148810665 splice site probably null
R1703:Ipo8 UTSW 6 148789892 missense probably benign 0.00
R1709:Ipo8 UTSW 6 148782728 missense probably benign
R2079:Ipo8 UTSW 6 148789162 missense probably damaging 1.00
R2338:Ipo8 UTSW 6 148789823 missense probably benign 0.00
R2359:Ipo8 UTSW 6 148816477 splice site probably benign
R2696:Ipo8 UTSW 6 148796741 missense probably benign 0.01
R3407:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3408:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3709:Ipo8 UTSW 6 148806344 intron probably null
R3710:Ipo8 UTSW 6 148806344 intron probably null
R3945:Ipo8 UTSW 6 148818117 missense probably damaging 1.00
R4326:Ipo8 UTSW 6 148800164 unclassified probably benign
R4329:Ipo8 UTSW 6 148800164 unclassified probably benign
R6105:Ipo8 UTSW 6 148798670 missense probably damaging 1.00
R6148:Ipo8 UTSW 6 148799780 missense probably damaging 1.00
R6359:Ipo8 UTSW 6 148777250 missense probably benign 0.01
R6377:Ipo8 UTSW 6 148816497 nonsense probably null
R6724:Ipo8 UTSW 6 148809975 splice site probably null
R7283:Ipo8 UTSW 6 148824481 missense possibly damaging 0.86
R7436:Ipo8 UTSW 6 148789805 missense probably benign 0.13
R7445:Ipo8 UTSW 6 148789817 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGCAAGTGAACACACTGTTTGTC -3'
(R):5'- TATCCATGCTCAGTGGTGCCTGAC -3'

Sequencing Primer
(F):5'- GAACACACTGTTTGTCTCAGCG -3'
(R):5'- GCCTGACTGTAGGTGTATAACAAAC -3'
Posted On2014-03-14