Incidental Mutation 'R1417:Prss23'
ID159853
Institutional Source Beutler Lab
Gene Symbol Prss23
Ensembl Gene ENSMUSG00000039405
Gene Nameprotease, serine 23
Synonyms2310046G15Rik
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location89507783-89527187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89510184 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 226 (T226S)
Ref Sequence ENSEMBL: ENSMUSP00000147183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041761] [ENSMUST00000207538] [ENSMUST00000207636] [ENSMUST00000207932] [ENSMUST00000208402] [ENSMUST00000208888] [ENSMUST00000208903]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032858
Predicted Effect probably damaging
Transcript: ENSMUST00000041761
AA Change: T226S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045191
Gene: ENSMUSG00000039405
AA Change: T226S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 48 57 N/A INTRINSIC
Tryp_SPc 137 372 2.87e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179361
Predicted Effect probably benign
Transcript: ENSMUST00000207538
Predicted Effect probably benign
Transcript: ENSMUST00000207636
Predicted Effect probably damaging
Transcript: ENSMUST00000207932
AA Change: T226S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208814
Predicted Effect probably benign
Transcript: ENSMUST00000208888
Predicted Effect probably benign
Transcript: ENSMUST00000208903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209118
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels of this gene after ovulation was induced. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Prss23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Prss23 APN 7 89509887 missense possibly damaging 0.83
IGL03308:Prss23 APN 7 89509730 missense probably benign 0.09
IGL03349:Prss23 APN 7 89509857 missense probably benign 0.09
IGL03378:Prss23 APN 7 89510144 missense probably damaging 0.99
R0394:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R1026:Prss23 UTSW 7 89509958 missense probably benign 0.01
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1691:Prss23 UTSW 7 89510714 missense probably benign 0.18
R1806:Prss23 UTSW 7 89510391 missense probably damaging 1.00
R2153:Prss23 UTSW 7 89509911 missense probably damaging 1.00
R3420:Prss23 UTSW 7 89509899 missense possibly damaging 0.91
R3849:Prss23 UTSW 7 89509751 missense probably damaging 1.00
R4567:Prss23 UTSW 7 89510866 utr 5 prime probably benign
R4828:Prss23 UTSW 7 89509900 nonsense probably null
R5010:Prss23 UTSW 7 89510214 missense probably benign 0.25
R5251:Prss23 UTSW 7 89510322 missense probably damaging 1.00
R5399:Prss23 UTSW 7 89509966 missense probably benign 0.02
R5629:Prss23 UTSW 7 89510192 missense probably damaging 1.00
R5697:Prss23 UTSW 7 89509982 missense probably damaging 0.99
R6378:Prss23 UTSW 7 89510033 missense probably damaging 1.00
R6716:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R6880:Prss23 UTSW 7 89510825 missense probably benign 0.03
R7097:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R7362:Prss23 UTSW 7 89509764 missense probably damaging 1.00
R7563:Prss23 UTSW 7 89509830 missense probably damaging 1.00
R7637:Prss23 UTSW 7 89510246 missense probably benign 0.00
R7815:Prss23 UTSW 7 89510045 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACATCACAGAAGCGGTACACC -3'
(R):5'- GGGCATCTACATCCTCAGCAATGG -3'

Sequencing Primer
(F):5'- GGTACACCAAATTGCCGGG -3'
(R):5'- TCTACATCCTCAGCAATGGTGAAG -3'
Posted On2014-03-14