Incidental Mutation 'R1417:Ces1a'
ID159855
Institutional Source Beutler Lab
Gene Symbol Ces1a
Ensembl Gene ENSMUSG00000071047
Gene Namecarboxylesterase 1A
SynonymsGm4976
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93020214-93048192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93022416 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 456 (D456N)
Ref Sequence ENSEMBL: ENSMUSP00000092836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095211]
Predicted Effect probably benign
Transcript: ENSMUST00000095211
AA Change: D456N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092836
Gene: ENSMUSG00000071047
AA Change: D456N

DomainStartEndE-ValueType
Pfam:COesterase 1 545 5.7e-169 PFAM
Pfam:Abhydrolase_3 136 286 8.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210764
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Ces1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Ces1a APN 8 93020467 missense probably damaging 1.00
IGL00556:Ces1a APN 8 93045059 missense probably benign 0.03
IGL00841:Ces1a APN 8 93039536 nonsense probably null
IGL01510:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01511:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01518:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01519:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01520:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01526:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01527:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01828:Ces1a APN 8 93025201 missense probably damaging 0.96
IGL01934:Ces1a APN 8 93032650 missense probably damaging 0.99
IGL02456:Ces1a APN 8 93039498 missense possibly damaging 0.56
IGL02712:Ces1a APN 8 93036040 missense probably damaging 1.00
IGL02982:Ces1a APN 8 93044975 missense probably damaging 1.00
IGL03178:Ces1a APN 8 93020889 missense probably damaging 1.00
IGL03377:Ces1a APN 8 93039488 missense probably damaging 1.00
R0556:Ces1a UTSW 8 93045112 missense probably benign 0.01
R0613:Ces1a UTSW 8 93025581 missense probably benign 0.11
R0627:Ces1a UTSW 8 93042043 missense probably benign 0.03
R0686:Ces1a UTSW 8 93022449 missense probably damaging 1.00
R0724:Ces1a UTSW 8 93039513 missense probably damaging 0.98
R0930:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1063:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1215:Ces1a UTSW 8 93032690 missense probably damaging 1.00
R1381:Ces1a UTSW 8 93034031 missense probably damaging 0.98
R1850:Ces1a UTSW 8 93027326 missense probably damaging 1.00
R2072:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2074:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2075:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2114:Ces1a UTSW 8 93039551 missense possibly damaging 0.93
R2213:Ces1a UTSW 8 93025225 missense probably damaging 1.00
R2346:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2347:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2483:Ces1a UTSW 8 93027341 missense probably damaging 1.00
R4515:Ces1a UTSW 8 93020904 missense probably damaging 1.00
R4587:Ces1a UTSW 8 93025304 missense probably damaging 1.00
R4691:Ces1a UTSW 8 93032659 missense probably benign 0.00
R4992:Ces1a UTSW 8 93045022 missense probably benign 0.08
R5074:Ces1a UTSW 8 93032675 missense possibly damaging 0.77
R6086:Ces1a UTSW 8 93027353 missense probably benign 0.03
Z1088:Ces1a UTSW 8 93025607 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGATCATGAGGGTGACTACTTTGGC -3'
(R):5'- AAGCTGTGTTTCCCTTCTAGCTGTG -3'

Sequencing Primer
(F):5'- cagtgtgaccagccaacc -3'
(R):5'- GGATTTTCAGTGACTTTATACCACC -3'
Posted On2014-03-14