Incidental Mutation 'R1417:Edc4'
List |< first << previous [record 8 of 36] next >> last >|
ID159856
Institutional Source Beutler Lab
Gene Symbol Edc4
Ensembl Gene ENSMUSG00000036270
Gene Nameenhancer of mRNA decapping 4
Synonyms
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105880881-105894908 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 105887855 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040254] [ENSMUST00000119261] [ENSMUST00000136048] [ENSMUST00000145618] [ENSMUST00000145618]
Predicted Effect probably null
Transcript: ENSMUST00000040254
SMART Domains Protein: ENSMUSP00000039134
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
coiled coil region 1001 1030 N/A INTRINSIC
low complexity region 1267 1285 N/A INTRINSIC
PDB:2VXG|B 1286 1402 3e-18 PDB
Predicted Effect probably null
Transcript: ENSMUST00000119261
SMART Domains Protein: ENSMUSP00000113854
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
coiled coil region 985 1014 N/A INTRINSIC
low complexity region 1251 1269 N/A INTRINSIC
PDB:2VXG|B 1270 1386 3e-18 PDB
Predicted Effect probably null
Transcript: ENSMUST00000132680
SMART Domains Protein: ENSMUSP00000114209
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
low complexity region 189 224 N/A INTRINSIC
low complexity region 245 273 N/A INTRINSIC
low complexity region 354 366 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132680
SMART Domains Protein: ENSMUSP00000114209
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
low complexity region 189 224 N/A INTRINSIC
low complexity region 245 273 N/A INTRINSIC
low complexity region 354 366 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136048
SMART Domains Protein: ENSMUSP00000114285
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
Blast:WD40 33 93 9e-8 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
low complexity region 549 584 N/A INTRINSIC
low complexity region 604 632 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
low complexity region 961 990 N/A INTRINSIC
low complexity region 1215 1233 N/A INTRINSIC
PDB:2VXG|B 1234 1317 1e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139154
Predicted Effect probably null
Transcript: ENSMUST00000145618
SMART Domains Protein: ENSMUSP00000118162
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
low complexity region 185 220 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000145618
SMART Domains Protein: ENSMUSP00000118162
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
low complexity region 185 220 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156357
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is thought to promote mRNA decay, and is known to interact with several mRNA decapping proteins. In humans, decreased expression of this gene prevents the accumulation of mRNA decapping proteins to mRNA processing bodies (P-body). Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Edc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Edc4 APN 8 105881123 missense probably damaging 1.00
IGL01069:Edc4 APN 8 105887134 missense probably benign 0.35
IGL01470:Edc4 APN 8 105889981 unclassified probably benign
IGL01656:Edc4 APN 8 105886377 missense possibly damaging 0.55
IGL01804:Edc4 APN 8 105890657 missense possibly damaging 0.92
IGL02135:Edc4 APN 8 105885822 missense probably damaging 1.00
IGL02825:Edc4 APN 8 105890611 missense probably damaging 1.00
IGL03036:Edc4 APN 8 105887311 unclassified probably null
IGL03401:Edc4 APN 8 105887514 nonsense probably null
IGL03409:Edc4 APN 8 105885116 missense probably damaging 1.00
Armor UTSW 8 105890867 missense probably damaging 1.00
mail UTSW 8 105886309 splice site probably null
R0362:Edc4 UTSW 8 105886775 missense probably damaging 1.00
R0541:Edc4 UTSW 8 105889428 missense probably benign 0.00
R0614:Edc4 UTSW 8 105889396 missense possibly damaging 0.93
R0631:Edc4 UTSW 8 105890792 missense possibly damaging 0.57
R1067:Edc4 UTSW 8 105891005 missense probably damaging 0.97
R1270:Edc4 UTSW 8 105891264 missense possibly damaging 0.90
R1371:Edc4 UTSW 8 105890750 unclassified probably benign
R1384:Edc4 UTSW 8 105892382 missense probably damaging 1.00
R1423:Edc4 UTSW 8 105891211 unclassified probably benign
R1446:Edc4 UTSW 8 105888132 missense probably damaging 0.96
R1472:Edc4 UTSW 8 105892828 missense probably damaging 0.99
R1797:Edc4 UTSW 8 105891085 missense probably benign 0.03
R2086:Edc4 UTSW 8 105888002 missense probably damaging 1.00
R2092:Edc4 UTSW 8 105887528 missense probably damaging 1.00
R3079:Edc4 UTSW 8 105885118 missense possibly damaging 0.86
R3551:Edc4 UTSW 8 105885494 missense probably damaging 1.00
R4492:Edc4 UTSW 8 105885068 frame shift probably null
R4650:Edc4 UTSW 8 105892675 nonsense probably null
R4735:Edc4 UTSW 8 105887186 missense probably damaging 1.00
R4854:Edc4 UTSW 8 105887925 intron probably benign
R5530:Edc4 UTSW 8 105889254 nonsense probably null
R5851:Edc4 UTSW 8 105890867 missense probably damaging 1.00
R5889:Edc4 UTSW 8 105888022 missense possibly damaging 0.87
R5903:Edc4 UTSW 8 105890587 missense probably benign 0.04
R5996:Edc4 UTSW 8 105887401 missense probably damaging 1.00
R6078:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6079:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6143:Edc4 UTSW 8 105885874 missense probably damaging 1.00
R7072:Edc4 UTSW 8 105888002 missense probably damaging 1.00
R7211:Edc4 UTSW 8 105886309 splice site probably null
R7368:Edc4 UTSW 8 105888405 small deletion probably benign
R7429:Edc4 UTSW 8 105891584 missense probably damaging 1.00
R7430:Edc4 UTSW 8 105891584 missense probably damaging 1.00
R7787:Edc4 UTSW 8 105887514 nonsense probably null
RF009:Edc4 UTSW 8 105889180 missense probably benign 0.27
RF014:Edc4 UTSW 8 105884600 missense probably benign
U15987:Edc4 UTSW 8 105887548 missense probably benign 0.01
X0018:Edc4 UTSW 8 105887001 missense probably damaging 1.00
X0063:Edc4 UTSW 8 105884580 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGTGTTGCTCATGCAGGTCCTC -3'
(R):5'- AAGCTGCCTAGTCAGGTCTCCAAG -3'

Sequencing Primer
(F):5'- ATCCAGGTTGTCAGTCGC -3'
(R):5'- ACAGCAGTGGAACCTGTCTC -3'
Posted On2014-03-14