Incidental Mutation 'R1417:Galns'
ID159858
Institutional Source Beutler Lab
Gene Symbol Galns
Ensembl Gene ENSMUSG00000015027
Gene Namegalactosamine (N-acetyl)-6-sulfate sulfatase
SynonymsN-acetylgalactosamine-6-sulfate sulfatase
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122578242-122611463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122584913 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 453 (S453G)
Ref Sequence ENSEMBL: ENSMUSP00000015171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015171] [ENSMUST00000127664] [ENSMUST00000212319]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015171
AA Change: S453G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015171
Gene: ENSMUSG00000015027
AA Change: S453G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 28 353 2.3e-91 PFAM
Pfam:Phosphodiest 30 315 2.1e-11 PFAM
Pfam:Sulfatase_C 376 507 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211906
Predicted Effect probably benign
Transcript: ENSMUST00000212319
AA Change: S373G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes N-acetylgalactosamine-6-sulfatase which is a lysosomal exohydrolase required for the degradation of the glycosaminoglycans, keratan sulfate, and chondroitin 6-sulfate. Sequence alterations including point, missense and nonsense mutations, as well as those that affect splicing, result in a deficiency of this enzyme. Deficiencies of this enzyme lead to Morquio A syndrome, a lysosomal storage disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile, and healthy in spite of lysosmal storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Galns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Galns APN 8 122598626 missense probably damaging 1.00
IGL02401:Galns APN 8 122605199 missense probably damaging 1.00
brimstone UTSW 8 122600610 missense probably damaging 1.00
fiend UTSW 8 122611338 start codon destroyed probably null
vesuvius UTSW 8 122599348 splice site probably null
R0001:Galns UTSW 8 122595883 splice site probably benign
R0018:Galns UTSW 8 122584985 missense probably benign 0.09
R1636:Galns UTSW 8 122604216 splice site probably benign
R4729:Galns UTSW 8 122603456 missense probably damaging 1.00
R4851:Galns UTSW 8 122600533 missense probably damaging 1.00
R4891:Galns UTSW 8 122599156 missense possibly damaging 0.92
R5218:Galns UTSW 8 122598589 missense probably damaging 0.99
R5532:Galns UTSW 8 122585026 missense possibly damaging 0.83
R6323:Galns UTSW 8 122598651 missense probably damaging 1.00
R6444:Galns UTSW 8 122611338 start codon destroyed probably null
R6495:Galns UTSW 8 122600610 missense probably damaging 1.00
R7215:Galns UTSW 8 122599348 splice site probably null
R7608:Galns UTSW 8 122591445 missense probably benign 0.06
R7612:Galns UTSW 8 122584954 missense possibly damaging 0.71
Z1177:Galns UTSW 8 122598523 missense probably benign 0.11
Z1177:Galns UTSW 8 122605206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTGCTGGGGTTGTCAATGAAC -3'
(R):5'- ATCTCTGCTGCATGGGCTTCTG -3'

Sequencing Primer
(F):5'- GGAGTTAGTAGGCTCTACATCCTC -3'
(R):5'- CTTCTGGGTCCTGGATGCC -3'
Posted On2014-03-14