Incidental Mutation 'R1417:Hbq1a'
ID159862
Institutional Source Beutler Lab
Gene Symbol Hbq1a
Ensembl Gene ENSMUSG00000020295
Gene Namehemoglobin, theta 1A
SynonymsA230090E05Rik, Hbq1, LOC380691
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location32300069-32300873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32300722 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 135 (D135G)
Ref Sequence ENSEMBL: ENSMUSP00000020535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020535] [ENSMUST00000093207]
Predicted Effect probably benign
Transcript: ENSMUST00000020535
AA Change: D135G

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020535
Gene: ENSMUSG00000020295
AA Change: D135G

DomainStartEndE-ValueType
Pfam:Globin 7 107 6.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093207
SMART Domains Protein: ENSMUSP00000090895
Gene: ENSMUSG00000069917

DomainStartEndE-ValueType
Pfam:Globin 7 107 7.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147010
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is one of two mouse theta-globin genes found in the alpha-globin gene cluster on chromosome 11. This gene represents the T2 (or 3') theta-globin gene described in PMIDs 18245844 and 11157800, respectively. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Hbq1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3120:Hbq1a UTSW 11 32300472 missense probably damaging 1.00
R3431:Hbq1a UTSW 11 32300715 missense probably benign
R3432:Hbq1a UTSW 11 32300715 missense probably benign
R3953:Hbq1a UTSW 11 32300214 critical splice donor site probably null
R3954:Hbq1a UTSW 11 32300214 critical splice donor site probably null
R3956:Hbq1a UTSW 11 32300214 critical splice donor site probably null
R6748:Hbq1a UTSW 11 32300169 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGGTTAAAGCCCATGCCCAAAAGG -3'
(R):5'- AGGCATACATGGACAGAAGCATCAC -3'

Sequencing Primer
(F):5'- TGCTAACTTCCAGGTGAGTC -3'
(R):5'- GGCACACATGTACAGCATTATC -3'
Posted On2014-03-14