Incidental Mutation 'R1417:Gm12185'
ID159863
Institutional Source Beutler Lab
Gene Symbol Gm12185
Ensembl Gene ENSMUSG00000048852
Gene Namepredicted gene 12185
Synonyms
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48904656-48992226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 48907842 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 608 (V608G)
Ref Sequence ENSEMBL: ENSMUSP00000092049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059930] [ENSMUST00000094476]
Predicted Effect probably damaging
Transcript: ENSMUST00000059930
AA Change: V608G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054351
Gene: ENSMUSG00000048852
AA Change: V608G

DomainStartEndE-ValueType
Pfam:IIGP 27 389 8.4e-123 PFAM
Pfam:MMR_HSR1 63 190 2.2e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 3.4e-152 PFAM
Pfam:MMR_HSR1 474 632 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094476
AA Change: V608G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092049
Gene: ENSMUSG00000048852
AA Change: V608G

DomainStartEndE-ValueType
Pfam:IIGP 27 389 1e-122 PFAM
Pfam:DLIC 43 98 3.2e-5 PFAM
Pfam:MMR_HSR1 63 187 6e-9 PFAM
low complexity region 421 432 N/A INTRINSIC
Pfam:IIGP 438 811 8.9e-153 PFAM
Pfam:MMR_HSR1 474 615 2.6e-7 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Gm12185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gm12185 APN 11 48907222 missense probably benign 0.01
IGL00495:Gm12185 APN 11 48907861 missense probably damaging 0.99
IGL01763:Gm12185 APN 11 48915844 missense probably benign 0.07
IGL01919:Gm12185 APN 11 48908059 missense possibly damaging 0.90
IGL03388:Gm12185 APN 11 48908286 missense probably benign 0.01
IGL03404:Gm12185 APN 11 48908037 missense probably damaging 1.00
PIT4458001:Gm12185 UTSW 11 48907911 missense probably damaging 1.00
R0347:Gm12185 UTSW 11 48915182 missense probably benign 0.29
R0488:Gm12185 UTSW 11 48907839 missense probably damaging 1.00
R1168:Gm12185 UTSW 11 48915355 missense possibly damaging 0.60
R1223:Gm12185 UTSW 11 48907276 missense probably damaging 0.98
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1468:Gm12185 UTSW 11 48915674 missense possibly damaging 0.60
R1519:Gm12185 UTSW 11 48907767 missense probably damaging 1.00
R1558:Gm12185 UTSW 11 48915435 missense probably damaging 0.99
R1630:Gm12185 UTSW 11 48907890 missense probably benign 0.31
R1758:Gm12185 UTSW 11 48908032 missense possibly damaging 0.82
R1793:Gm12185 UTSW 11 48915756 nonsense probably null
R1908:Gm12185 UTSW 11 48915404 missense probably benign 0.00
R1983:Gm12185 UTSW 11 48915356 missense probably benign 0.01
R3917:Gm12185 UTSW 11 48915933 missense probably benign 0.01
R3969:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R3970:Gm12185 UTSW 11 48907345 missense probably benign 0.03
R4510:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4511:Gm12185 UTSW 11 48908478 missense possibly damaging 0.84
R4529:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4529:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4532:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4532:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4533:Gm12185 UTSW 11 48907920 missense probably damaging 1.00
R4533:Gm12185 UTSW 11 48908094 missense possibly damaging 0.66
R4678:Gm12185 UTSW 11 48915540 missense probably benign 0.05
R5094:Gm12185 UTSW 11 48907548 missense probably benign 0.35
R5238:Gm12185 UTSW 11 48908217 missense possibly damaging 0.92
R5306:Gm12185 UTSW 11 48915555 missense probably benign 0.03
R5371:Gm12185 UTSW 11 48915739 missense probably benign 0.01
R5995:Gm12185 UTSW 11 48915713 missense probably benign 0.40
R6113:Gm12185 UTSW 11 48915340 missense possibly damaging 0.47
R6147:Gm12185 UTSW 11 48915890 missense probably benign
R6160:Gm12185 UTSW 11 48908428 nonsense probably null
R6247:Gm12185 UTSW 11 48915908 missense probably damaging 0.98
R6264:Gm12185 UTSW 11 48916175 missense probably benign 0.01
R6748:Gm12185 UTSW 11 48916296 missense possibly damaging 0.53
R6765:Gm12185 UTSW 11 48915704 missense probably benign 0.12
R6970:Gm12185 UTSW 11 48907912 nonsense probably null
R7028:Gm12185 UTSW 11 48908244 missense possibly damaging 0.80
R7033:Gm12185 UTSW 11 48915999 missense probably benign
R7512:Gm12185 UTSW 11 48915890 missense probably benign
R7609:Gm12185 UTSW 11 48916023 missense possibly damaging 0.82
R7673:Gm12185 UTSW 11 48907628 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CGGGCAATGGTAGTCTCAGTAACAC -3'
(R):5'- GCATTGGGTCAACCAACTTCCCAC -3'

Sequencing Primer
(F):5'- GTCTCAGTAACACTGTGCAAG -3'
(R):5'- AAgtttggtgagtatgacttcttc -3'
Posted On2014-03-14