Incidental Mutation 'R1417:Klhl11'
List |< first << previous [record 17 of 36] next >> last >|
ID159866
Institutional Source Beutler Lab
Gene Symbol Klhl11
Ensembl Gene ENSMUSG00000048732
Gene Namekelch-like 11
Synonyms
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R1417 (G1)
Quality Score138
Status Not validated
Chromosome11
Chromosomal Location100462614-100472741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100472289 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 147 (E147G)
Ref Sequence ENSEMBL: ENSMUSP00000054963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007131] [ENSMUST00000056665] [ENSMUST00000107389] [ENSMUST00000165111]
Predicted Effect probably benign
Transcript: ENSMUST00000007131
SMART Domains Protein: ENSMUSP00000007131
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056665
AA Change: E147G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054963
Gene: ENSMUSG00000048732
AA Change: E147G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
BTB 95 201 2.69e-21 SMART
BACK 206 308 9.54e-26 SMART
Kelch 361 408 4.1e0 SMART
Kelch 409 454 2.61e-1 SMART
Kelch 455 502 2.17e-1 SMART
Kelch 611 662 1.39e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107389
SMART Domains Protein: ENSMUSP00000103012
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:Citrate_bind 244 421 1.7e-94 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 494 600 6.6e-15 PFAM
Pfam:Ligase_CoA 660 785 2.1e-16 PFAM
Pfam:Citrate_synt 879 1085 2e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154151
Predicted Effect probably benign
Transcript: ENSMUST00000165111
SMART Domains Protein: ENSMUSP00000127632
Gene: ENSMUSG00000020917

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Klhl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Klhl11 APN 11 100463205 missense possibly damaging 0.94
IGL02334:Klhl11 APN 11 100463836 missense probably damaging 1.00
IGL02886:Klhl11 APN 11 100472221 missense possibly damaging 0.92
R0372:Klhl11 UTSW 11 100463522 missense probably damaging 0.97
R0583:Klhl11 UTSW 11 100464324 missense possibly damaging 0.57
R0608:Klhl11 UTSW 11 100472242 missense probably damaging 1.00
R0609:Klhl11 UTSW 11 100463714 missense probably damaging 1.00
R1629:Klhl11 UTSW 11 100464186 missense probably benign 0.00
R1643:Klhl11 UTSW 11 100463015 missense probably benign 0.09
R1985:Klhl11 UTSW 11 100463244 missense probably benign 0.00
R3844:Klhl11 UTSW 11 100472307 missense possibly damaging 0.84
R4746:Klhl11 UTSW 11 100464350 missense probably benign 0.00
R5053:Klhl11 UTSW 11 100472200 missense probably damaging 1.00
R5426:Klhl11 UTSW 11 100464116 missense probably damaging 1.00
R5731:Klhl11 UTSW 11 100463763 missense probably damaging 1.00
R5755:Klhl11 UTSW 11 100464351 missense probably benign 0.00
R6874:Klhl11 UTSW 11 100472205 missense probably benign 0.00
R7295:Klhl11 UTSW 11 100472242 missense probably damaging 1.00
R7426:Klhl11 UTSW 11 100464352 missense probably benign 0.17
R7554:Klhl11 UTSW 11 100463948 missense probably benign
Z1177:Klhl11 UTSW 11 100463966 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTCTCTTGCCACTGCGAAGCTG -3'
(R):5'- TGTTCTGCGACATCACCCTGTG -3'

Sequencing Primer
(F):5'- TGTCATCATCACAGGAGTCG -3'
(R):5'- GACATCACCCTGTGCTTCG -3'
Posted On2014-03-14