Incidental Mutation 'R1417:Olfr722'
ID159869
Institutional Source Beutler Lab
Gene Symbol Olfr722
Ensembl Gene ENSMUSG00000048933
Gene Nameolfactory receptor 722
SynonymsGA_x6K02T2PMLR-5566715-5565789, MOR241-3
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location49894258-49901999 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 49895563 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 80 (R80*)
Ref Sequence ENSEMBL: ENSMUSP00000059721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053290]
Predicted Effect probably null
Transcript: ENSMUST00000053290
AA Change: R80*
SMART Domains Protein: ENSMUSP00000059721
Gene: ENSMUSG00000048933
AA Change: R80*

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 4.3e-44 PFAM
Pfam:7tm_1 41 288 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213271
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Olfr722
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1229:Olfr722 UTSW 14 49895254 nonsense probably null
R1400:Olfr722 UTSW 14 49895691 missense possibly damaging 0.49
R2126:Olfr722 UTSW 14 49895067 missense probably benign 0.01
R3968:Olfr722 UTSW 14 49895526 missense probably damaging 1.00
R4008:Olfr722 UTSW 14 49895007 missense probably benign 0.00
R4032:Olfr722 UTSW 14 49894976 missense probably benign 0.22
R4409:Olfr722 UTSW 14 49895773 missense probably benign 0.01
R4934:Olfr722 UTSW 14 49895749 missense probably benign 0.00
R5110:Olfr722 UTSW 14 49895575 missense possibly damaging 0.49
R5232:Olfr722 UTSW 14 49895698 missense probably damaging 1.00
R7019:Olfr722 UTSW 14 49895667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCACAAAAGGGCAAGTTTAG -3'
(R):5'- AAGCTCAACTCCTGGTCTTCGCAC -3'

Sequencing Primer
(F):5'- TGTACAATGGAATGAGCAAAACCC -3'
(R):5'- CGCACTGATTTCAGTTTTCTACC -3'
Posted On2014-03-14