Incidental Mutation 'R1417:Lrp5'
ID159878
Institutional Source Beutler Lab
Gene Symbol Lrp5
Ensembl Gene ENSMUSG00000024913
Gene Namelow density lipoprotein receptor-related protein 5
SynonymsLR3, LRP7
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3584828-3686564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3586425 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1514 (V1514A)
Ref Sequence ENSEMBL: ENSMUSP00000025856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025856] [ENSMUST00000177294] [ENSMUST00000177330]
Predicted Effect probably benign
Transcript: ENSMUST00000025856
AA Change: V1514A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913
AA Change: V1514A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
EGF 603 640 2.48e-1 SMART
LY 666 708 5.92e-8 SMART
LY 709 751 5.65e-14 SMART
LY 752 795 3.81e-11 SMART
LY 796 837 3.54e-6 SMART
LY 838 877 1.33e-1 SMART
EGF 904 941 1.22e0 SMART
LY 968 1009 4.39e-2 SMART
LY 1015 1057 1.81e0 SMART
LY 1058 1102 9.47e-7 SMART
LY 1103 1145 6.91e-9 SMART
LY 1146 1186 1.53e0 SMART
EGF 1215 1253 2.85e-1 SMART
LDLa 1257 1296 1.23e-13 SMART
LDLa 1297 1333 3.26e-9 SMART
LDLa 1334 1371 1.31e-13 SMART
transmembrane domain 1384 1406 N/A INTRINSIC
low complexity region 1494 1503 N/A INTRINSIC
low complexity region 1571 1578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177294
SMART Domains Protein: ENSMUSP00000134771
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
LY 1 26 1.88e1 SMART
LY 27 70 3.81e-11 SMART
LY 71 112 3.54e-6 SMART
LY 113 152 1.33e-1 SMART
EGF 179 216 1.22e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177330
SMART Domains Protein: ENSMUSP00000134983
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Lrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Lrp5 APN 19 3649404 missense probably benign
IGL00902:Lrp5 APN 19 3600774 missense probably damaging 1.00
IGL02032:Lrp5 APN 19 3615886 splice site probably benign
IGL02331:Lrp5 APN 19 3591816 missense possibly damaging 0.64
IGL02401:Lrp5 APN 19 3593585 missense probably damaging 1.00
IGL02471:Lrp5 APN 19 3602408 missense probably benign 0.31
IGL02572:Lrp5 APN 19 3614283 missense probably benign 0.17
IGL02637:Lrp5 APN 19 3630269 missense probably benign 0.03
IGL02696:Lrp5 APN 19 3602253 missense probably benign
IGL02742:Lrp5 APN 19 3604022 missense probably damaging 0.99
IGL02804:Lrp5 APN 19 3600777 missense possibly damaging 0.63
IGL03089:Lrp5 APN 19 3620314 splice site probably null
IGL03243:Lrp5 APN 19 3630159 missense probably benign 0.12
r18 UTSW 19 small insertion
PIT4494001:Lrp5 UTSW 19 3610091 missense probably damaging 1.00
R0219:Lrp5 UTSW 19 3597349 missense probably damaging 1.00
R0526:Lrp5 UTSW 19 3628295 missense probably damaging 1.00
R0597:Lrp5 UTSW 19 3600777 missense possibly damaging 0.63
R0883:Lrp5 UTSW 19 3605308 missense probably damaging 1.00
R1086:Lrp5 UTSW 19 3649476 missense probably benign 0.28
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1533:Lrp5 UTSW 19 3614234 missense probably benign 0.17
R1538:Lrp5 UTSW 19 3647585 missense possibly damaging 0.70
R1856:Lrp5 UTSW 19 3597346 missense probably benign 0.18
R1930:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1931:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1932:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1951:Lrp5 UTSW 19 3620298 missense possibly damaging 0.89
R2016:Lrp5 UTSW 19 3610056 missense probably benign 0.04
R2131:Lrp5 UTSW 19 3622708 missense possibly damaging 0.87
R2153:Lrp5 UTSW 19 3614339 missense probably benign 0.22
R2403:Lrp5 UTSW 19 3597430 missense probably damaging 1.00
R3158:Lrp5 UTSW 19 3615849 missense probably damaging 0.97
R3771:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3772:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3773:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3825:Lrp5 UTSW 19 3605290 nonsense probably null
R3887:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3888:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3893:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3917:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R4279:Lrp5 UTSW 19 3591778 missense possibly damaging 0.94
R4714:Lrp5 UTSW 19 3659454 missense probably damaging 1.00
R4825:Lrp5 UTSW 19 3614292 missense probably damaging 1.00
R5102:Lrp5 UTSW 19 3659304 missense probably damaging 0.96
R5138:Lrp5 UTSW 19 3628319 missense probably benign 0.03
R5497:Lrp5 UTSW 19 3602319 missense probably damaging 1.00
R5632:Lrp5 UTSW 19 3622512 missense probably benign
R5887:Lrp5 UTSW 19 3604094 missense probably benign 0.01
R5950:Lrp5 UTSW 19 3602333 missense probably benign 0.17
R5987:Lrp5 UTSW 19 3628299 missense probably damaging 1.00
R6080:Lrp5 UTSW 19 3628316 missense probably benign 0.32
R6181:Lrp5 UTSW 19 3628427 missense probably damaging 1.00
R6236:Lrp5 UTSW 19 3630483 splice site probably null
R6332:Lrp5 UTSW 19 3659355 missense probably damaging 1.00
R6511:Lrp5 UTSW 19 3652296 missense probably damaging 1.00
R6641:Lrp5 UTSW 19 3652287 missense probably damaging 1.00
R6791:Lrp5 UTSW 19 3600753 missense probably damaging 1.00
R6865:Lrp5 UTSW 19 3620013 critical splice donor site probably null
R6906:Lrp5 UTSW 19 3622638 missense probably damaging 1.00
R6922:Lrp5 UTSW 19 3605301 missense probably damaging 1.00
R7091:Lrp5 UTSW 19 3630184 missense probably damaging 1.00
R7303:Lrp5 UTSW 19 3591774 missense probably damaging 0.99
R7368:Lrp5 UTSW 19 3620085 missense possibly damaging 0.95
R7381:Lrp5 UTSW 19 3593588 missense probably benign 0.20
R7385:Lrp5 UTSW 19 3612197 critical splice donor site probably null
R7392:Lrp5 UTSW 19 3610199 missense probably damaging 1.00
R7448:Lrp5 UTSW 19 3649439 missense probably benign 0.01
R7585:Lrp5 UTSW 19 3604094 missense possibly damaging 0.88
R7662:Lrp5 UTSW 19 3686353 critical splice donor site probably null
R8056:Lrp5 UTSW 19 3597337 missense probably damaging 0.98
Z1177:Lrp5 UTSW 19 3628345 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGGTGTCTCAAGCAATGGAGAAG -3'
(R):5'- TTTGGGGAAGATGGCTGATGCCAC -3'

Sequencing Primer
(F):5'- CACTTGTATAAAACCAGCTCTGAG -3'
(R):5'- CCTAAGTTTCACTAGCTCTGGAAGG -3'
Posted On2014-03-14