Incidental Mutation 'R1417:Cnnm1'
ID159879
Institutional Source Beutler Lab
Gene Symbol Cnnm1
Ensembl Gene ENSMUSG00000025189
Gene Namecyclin M1
SynonymsAcdp1
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location43440436-43497210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43469723 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 658 (E658G)
Ref Sequence ENSEMBL: ENSMUSP00000131830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165311] [ENSMUST00000223787]
Predicted Effect probably benign
Transcript: ENSMUST00000165311
AA Change: E658G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131830
Gene: ENSMUSG00000025189
AA Change: E658G

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
low complexity region 78 95 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 165 183 N/A INTRINSIC
low complexity region 193 202 N/A INTRINSIC
Pfam:DUF21 224 414 1.8e-27 PFAM
Blast:CBS 438 489 2e-12 BLAST
CBS 505 561 5.02e0 SMART
Blast:cNMP 634 802 2e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000223787
AA Change: E658G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225421
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain protein family. The encoded protein may bind copper. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Cnnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Cnnm1 APN 19 43471936 missense probably benign 0.10
IGL02370:Cnnm1 APN 19 43471950 critical splice donor site probably null
R0329:Cnnm1 UTSW 19 43441910 missense probably damaging 1.00
R0400:Cnnm1 UTSW 19 43468364 missense probably damaging 1.00
R1478:Cnnm1 UTSW 19 43471856 missense probably damaging 1.00
R1743:Cnnm1 UTSW 19 43471913 missense possibly damaging 0.93
R2290:Cnnm1 UTSW 19 43491502 missense probably benign
R2509:Cnnm1 UTSW 19 43441886 missense probably damaging 1.00
R2910:Cnnm1 UTSW 19 43469647 missense possibly damaging 0.58
R3107:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3109:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3922:Cnnm1 UTSW 19 43440445 start codon destroyed probably null
R3923:Cnnm1 UTSW 19 43440445 start codon destroyed probably null
R4804:Cnnm1 UTSW 19 43491575 missense probably benign 0.02
R5199:Cnnm1 UTSW 19 43494986 missense possibly damaging 0.84
R5347:Cnnm1 UTSW 19 43441862 missense probably benign 0.42
R5595:Cnnm1 UTSW 19 43465157 missense possibly damaging 0.85
R5964:Cnnm1 UTSW 19 43469723 missense probably benign 0.42
R5969:Cnnm1 UTSW 19 43491472 missense probably damaging 1.00
R6383:Cnnm1 UTSW 19 43465266 critical splice donor site probably null
R7072:Cnnm1 UTSW 19 43440857 missense probably benign
R7092:Cnnm1 UTSW 19 43441948 missense probably damaging 1.00
R7126:Cnnm1 UTSW 19 43484853 missense probably damaging 1.00
R7432:Cnnm1 UTSW 19 43468271 missense probably benign 0.09
R7445:Cnnm1 UTSW 19 43440821 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGAAACCCCAGATGCTGCACTC -3'
(R):5'- AACATGCAGGCTTCTTACTGTCCC -3'

Sequencing Primer
(F):5'- AGATGCTGCACTCGCCTC -3'
(R):5'- GGGATACCACTCTTACATGCCTG -3'
Posted On2014-03-14