Incidental Mutation 'R1418:Creb3l4'
ID159897
Institutional Source Beutler Lab
Gene Symbol Creb3l4
Ensembl Gene ENSMUSG00000027938
Gene NamecAMP responsive element binding protein 3-like 4
SynonymsTisp40alpha, JAL, Tisp40beta, Tisp40, 1700012K17Rik, 5330432F22Rik, mJAL, ATCE1
MMRRC Submission 039474-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R1418 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90237500-90243512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90238738 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 193 (I193T)
Ref Sequence ENSEMBL: ENSMUSP00000102992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029546] [ENSMUST00000029547] [ENSMUST00000107369] [ENSMUST00000119304]
Predicted Effect probably benign
Transcript: ENSMUST00000029546
SMART Domains Protein: ENSMUSP00000029546
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:JTB 37 143 5.6e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000029547
AA Change: I193T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029547
Gene: ENSMUSG00000027938
AA Change: I193T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107369
AA Change: I193T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102992
Gene: ENSMUSG00000027938
AA Change: I193T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119304
SMART Domains Protein: ENSMUSP00000113763
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:JTB 30 95 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157045
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 97% (92/95)
MGI Phenotype FUNCTION: This gene encodes a CREB (cyclic AMP-responsive element-binding) protein with a transmembrane domain which localizes it to the ER membrane. The encoded protein may play a role in adiposity and male germ cell development. Homozygous knockout mice for this gene show increased adipogenesis, elevated testicular germ cell apoptosis and defects in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display oligozoospermia but have normal fertility and sperm morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Alb A G 5: 90,464,202 probably benign Het
Arnt A G 3: 95,470,399 probably benign Het
Asap2 A C 12: 21,239,585 N501H probably damaging Het
Asap2 A G 12: 21,239,589 E499G probably damaging Het
Atp5b C T 10: 128,083,298 probably benign Het
Atrnl1 G A 19: 57,935,705 probably null Het
AW554918 T G 18: 25,339,699 probably null Het
Bod1l G A 5: 41,819,471 T1500I probably damaging Het
Btbd11 C A 10: 85,645,578 T948K probably damaging Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dnah17 T A 11: 118,074,023 N2365Y probably damaging Het
Dnah7a T A 1: 53,647,236 probably benign Het
Dnajc16 G T 4: 141,767,741 S520* probably null Het
Dsg1b G T 18: 20,397,430 E381* probably null Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Endou A T 15: 97,718,973 probably benign Het
Epn2 A G 11: 61,523,086 S419P probably benign Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fat4 T C 3: 38,890,813 I1285T probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm13083 T A 4: 143,616,034 I237K probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gnas C T 2: 174,345,214 probably benign Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Hsd17b4 G T 18: 50,130,187 probably benign Het
Kmt2b A G 7: 30,576,960 probably benign Het
Lrch1 T C 14: 74,804,269 probably benign Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mtch2 A T 2: 90,853,015 probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Mug1 C T 6: 121,838,676 S13L probably benign Het
Naa25 T G 5: 121,423,734 L450R probably damaging Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nrp2 C T 1: 62,783,332 R695* probably null Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr373 T C 8: 72,100,387 L209P probably damaging Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Pclo A T 5: 14,678,130 probably benign Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Pkn3 T A 2: 30,083,047 V323E probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plppr2 C T 9: 21,947,789 P401S possibly damaging Het
Poln A G 5: 34,078,975 V604A probably benign Het
Prkd2 A G 7: 16,869,545 D800G probably benign Het
Ptprb A G 10: 116,319,470 T710A probably benign Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Ralbp1 A T 17: 65,859,148 probably benign Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Smcr8 T C 11: 60,778,032 I2T probably damaging Het
Smtnl2 T C 11: 72,401,421 T301A probably damaging Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Szt2 A T 4: 118,387,779 S1187T probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tfap2a T A 13: 40,717,204 M405L possibly damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tmem132b C A 5: 125,638,249 Q341K probably benign Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Utrn C T 10: 12,713,350 V871I probably benign Het
Vat1l T C 8: 114,282,361 probably benign Het
Vmn1r205 T C 13: 22,592,879 K18E probably benign Het
Zfp518a T A 19: 40,914,359 Y911N probably damaging Het
Zfyve28 A G 5: 34,217,246 C475R probably damaging Het
Other mutations in Creb3l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Creb3l4 APN 3 90241987 missense possibly damaging 0.95
IGL01015:Creb3l4 APN 3 90242831 start codon destroyed probably null
IGL01092:Creb3l4 APN 3 90237738 missense probably damaging 1.00
IGL02172:Creb3l4 APN 3 90242775 missense probably benign 0.21
IGL02291:Creb3l4 APN 3 90241983 missense probably benign 0.03
R1344:Creb3l4 UTSW 3 90238738 missense possibly damaging 0.73
R1836:Creb3l4 UTSW 3 90238903 missense probably benign 0.26
R2154:Creb3l4 UTSW 3 90238485 missense probably damaging 1.00
R2877:Creb3l4 UTSW 3 90242308 missense probably damaging 0.99
R4923:Creb3l4 UTSW 3 90242214 missense probably benign 0.00
R6024:Creb3l4 UTSW 3 90238699 missense probably damaging 1.00
R6683:Creb3l4 UTSW 3 90237805 missense probably benign 0.08
R7567:Creb3l4 UTSW 3 90242422 missense probably benign 0.00
Z1088:Creb3l4 UTSW 3 90237751 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGCCCCTTAACATGCTTTGGTG -3'
(R):5'- GCTTTGGAAGCAGGTGACCTTGAC -3'

Sequencing Primer
(F):5'- CTTAACATGCTTTGGTGAGAGAAAGG -3'
(R):5'- AGAAGGGATTACTCTGCCCTC -3'
Posted On2014-03-14