Incidental Mutation 'R1418:Dnajc16'
ID 159903
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission 039474-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.772) question?
Stock # R1418 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 141495052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 520 (S520*)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000038014
AA Change: S520*
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: S520*

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138654
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 97% (92/95)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,156,131 (GRCm39) probably benign Het
Abtb3 C A 10: 85,481,442 (GRCm39) T948K probably damaging Het
Adamts12 T A 15: 11,286,890 (GRCm39) W832R probably damaging Het
Alb A G 5: 90,612,061 (GRCm39) probably benign Het
Arnt A G 3: 95,377,710 (GRCm39) probably benign Het
Asap2 A C 12: 21,289,586 (GRCm39) N501H probably damaging Het
Asap2 A G 12: 21,289,590 (GRCm39) E499G probably damaging Het
Atp5f1b C T 10: 127,919,167 (GRCm39) probably benign Het
Atrnl1 G A 19: 57,924,137 (GRCm39) probably null Het
AW554918 T G 18: 25,472,756 (GRCm39) probably null Het
Bhmt1b A G 18: 87,775,458 (GRCm39) K327R probably damaging Het
Bltp3a A G 17: 28,113,551 (GRCm39) K1241R probably benign Het
Bod1l G A 5: 41,976,814 (GRCm39) T1500I probably damaging Het
Cd101 A T 3: 100,926,091 (GRCm39) Y209* probably null Het
Cdk12 T A 11: 98,132,611 (GRCm39) S1013R unknown Het
Cntd1 T A 11: 101,176,566 (GRCm39) L221Q possibly damaging Het
Cntn4 G A 6: 106,321,831 (GRCm39) probably null Het
Col17a1 T A 19: 47,659,944 (GRCm39) D336V probably damaging Het
Creb3l4 A G 3: 90,146,045 (GRCm39) I193T possibly damaging Het
Cyp2d10 A T 15: 82,290,106 (GRCm39) probably null Het
Dcun1d3 A G 7: 119,457,158 (GRCm39) F185L probably damaging Het
Dnah17 T A 11: 117,964,849 (GRCm39) N2365Y probably damaging Het
Dnah7a T A 1: 53,686,395 (GRCm39) probably benign Het
Dsg1b G T 18: 20,530,487 (GRCm39) E381* probably null Het
Dusp1 A G 17: 26,727,293 (GRCm39) V2A probably benign Het
Elf1 T C 14: 79,798,215 (GRCm39) V34A probably damaging Het
Endou A T 15: 97,616,854 (GRCm39) probably benign Het
Epn2 A G 11: 61,413,912 (GRCm39) S419P probably benign Het
Fat4 T C 3: 38,944,962 (GRCm39) I1285T probably damaging Het
Fcgr2b T C 1: 170,788,650 (GRCm39) Y319C probably damaging Het
Fhip2a G A 19: 57,359,594 (GRCm39) A45T possibly damaging Het
Gfra1 A C 19: 58,226,849 (GRCm39) S461A possibly damaging Het
Gli2 T G 1: 118,769,666 (GRCm39) I629L probably damaging Het
Gm17661 GA GAA 2: 90,917,709 (GRCm38) noncoding transcript Het
Gnas C T 2: 174,187,007 (GRCm39) probably benign Het
Gpx3 G A 11: 54,800,422 (GRCm39) V207I probably damaging Het
Hormad2 A G 11: 4,359,005 (GRCm39) probably null Het
Hsd17b4 G T 18: 50,263,254 (GRCm39) probably benign Het
Kmt2b A G 7: 30,276,385 (GRCm39) probably benign Het
Lrch1 T C 14: 75,041,709 (GRCm39) probably benign Het
Mark3 T C 12: 111,594,271 (GRCm39) I307T possibly damaging Het
Mroh8 G A 2: 157,083,774 (GRCm39) probably benign Het
Mtch2 A T 2: 90,683,359 (GRCm39) probably benign Het
Mtif2 G A 11: 29,495,002 (GRCm39) V701I probably benign Het
Mug1 C T 6: 121,815,635 (GRCm39) S13L probably benign Het
Naa25 T G 5: 121,561,797 (GRCm39) L450R probably damaging Het
Nr4a2 A T 2: 56,998,336 (GRCm39) N543K probably damaging Het
Nrp2 C T 1: 62,822,491 (GRCm39) R695* probably null Het
Or10ag53 G T 2: 87,082,766 (GRCm39) G162C probably benign Het
Or10s1 T A 9: 39,985,768 (GRCm39) L59H probably damaging Het
Or2z9 T C 8: 72,854,231 (GRCm39) L209P probably damaging Het
Otog G T 7: 45,924,039 (GRCm39) A1133S probably damaging Het
Pclo A T 5: 14,728,144 (GRCm39) probably benign Het
Pdcd11 A G 19: 47,118,516 (GRCm39) D1794G probably damaging Het
Pde4d C A 13: 110,086,921 (GRCm39) S609* probably null Het
Pkn3 T A 2: 29,973,059 (GRCm39) V323E probably damaging Het
Plekhd1 A G 12: 80,739,659 (GRCm39) T3A probably benign Het
Plekhg4 G A 8: 106,105,742 (GRCm39) A736T probably benign Het
Plppr2 C T 9: 21,859,085 (GRCm39) P401S possibly damaging Het
Poln A G 5: 34,236,319 (GRCm39) V604A probably benign Het
Pramel21 T A 4: 143,342,604 (GRCm39) I237K probably benign Het
Prkd2 A G 7: 16,603,470 (GRCm39) D800G probably benign Het
Ptprb A G 10: 116,155,375 (GRCm39) T710A probably benign Het
Qrfpr C A 3: 36,234,244 (GRCm39) G366W probably damaging Het
Qser1 C A 2: 104,607,776 (GRCm39) A1471S probably damaging Het
Ralbp1 A T 17: 66,166,143 (GRCm39) probably benign Het
Rars1 A T 11: 35,700,567 (GRCm39) Y505N probably damaging Het
Sec24b T C 3: 129,801,072 (GRCm39) N408S probably damaging Het
Slc38a9 T C 13: 112,826,714 (GRCm39) C151R probably benign Het
Smcr8 T C 11: 60,668,858 (GRCm39) I2T probably damaging Het
Smtnl2 T C 11: 72,292,247 (GRCm39) T301A probably damaging Het
Smyd1 G A 6: 71,239,151 (GRCm39) T13I probably benign Het
Sp110 G A 1: 85,522,106 (GRCm39) H66Y probably benign Het
Szt2 A T 4: 118,244,976 (GRCm39) S1187T probably benign Het
Tdo2 A G 3: 81,868,775 (GRCm39) probably null Het
Tfap2a T A 13: 40,870,680 (GRCm39) M405L possibly damaging Het
Thap12 A G 7: 98,366,037 (GRCm39) D735G probably damaging Het
Tmem132b C A 5: 125,715,313 (GRCm39) Q341K probably benign Het
Tnip3 T C 6: 65,574,413 (GRCm39) V88A probably benign Het
Trim45 G T 3: 100,834,614 (GRCm39) M432I probably benign Het
Ttn A G 2: 76,565,755 (GRCm39) V28199A possibly damaging Het
Ube3b T C 5: 114,556,636 (GRCm39) F989S probably damaging Het
Ubox5 A G 2: 130,442,210 (GRCm39) L159P probably damaging Het
Uevld A T 7: 46,587,758 (GRCm39) V314E possibly damaging Het
Urb1 T C 16: 90,566,354 (GRCm39) M1478V probably damaging Het
Utrn C T 10: 12,589,094 (GRCm39) V871I probably benign Het
Vat1l T C 8: 115,009,101 (GRCm39) probably benign Het
Vmn1r205 T C 13: 22,777,049 (GRCm39) K18E probably benign Het
Zfp518a T A 19: 40,902,803 (GRCm39) Y911N probably damaging Het
Zfyve28 A G 5: 34,374,590 (GRCm39) C475R probably damaging Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAAAGGCAGCAGAAGTCGGTTATC -3'
(R):5'- CCATCTTGGAAAGGAGGAACACAGC -3'

Sequencing Primer
(F):5'- AAGTCGGTTATCGGGCTGTG -3'
(R):5'- TGAGAGCGATAAGTTCGTCC -3'
Posted On 2014-03-14