Incidental Mutation 'R1418:Epn2'
ID159939
Institutional Source Beutler Lab
Gene Symbol Epn2
Ensembl Gene ENSMUSG00000001036
Gene Nameepsin 2
SynonymsIbp2, 9530051D10Rik
MMRRC Submission 039474-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1418 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61517249-61579687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61523086 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 419 (S419P)
Ref Sequence ENSEMBL: ENSMUSP00000104352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001063] [ENSMUST00000108711] [ENSMUST00000108712] [ENSMUST00000108713] [ENSMUST00000178202] [ENSMUST00000179936]
Predicted Effect probably benign
Transcript: ENSMUST00000001063
AA Change: S380P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001063
Gene: ENSMUSG00000001036
AA Change: S380P

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108711
AA Change: S362P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104351
Gene: ENSMUSG00000001036
AA Change: S362P

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 431 443 N/A INTRINSIC
low complexity region 475 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108712
AA Change: S419P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104352
Gene: ENSMUSG00000001036
AA Change: S419P

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 488 500 N/A INTRINSIC
low complexity region 532 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108713
AA Change: S368P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104353
Gene: ENSMUSG00000001036
AA Change: S368P

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 437 449 N/A INTRINSIC
low complexity region 481 505 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138136
Predicted Effect probably benign
Transcript: ENSMUST00000148956
SMART Domains Protein: ENSMUSP00000122514
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
SCOP:d1eyha_ 2 35 1e-9 SMART
PDB:1EDU|A 2 37 5e-8 PDB
UIM 152 171 6.29e-1 SMART
UIM 177 196 2.48e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178202
AA Change: S380P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136553
Gene: ENSMUSG00000001036
AA Change: S380P

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179936
AA Change: S425P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136950
Gene: ENSMUSG00000001036
AA Change: S425P

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 494 506 N/A INTRINSIC
low complexity region 538 562 N/A INTRINSIC
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 97% (92/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with clathrin and adaptor-related protein complex 2, alpha 1 subunit. The protein is found in a brain-derived clathrin-coated vesicle fraction and localizes to the peri-Golgi region and the cell periphery. The protein is thought to be involved in clathrin-mediated endocytosis. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Alb A G 5: 90,464,202 probably benign Het
Arnt A G 3: 95,470,399 probably benign Het
Asap2 A C 12: 21,239,585 N501H probably damaging Het
Asap2 A G 12: 21,239,589 E499G probably damaging Het
Atp5b C T 10: 128,083,298 probably benign Het
Atrnl1 G A 19: 57,935,705 probably null Het
AW554918 T G 18: 25,339,699 probably null Het
Bod1l G A 5: 41,819,471 T1500I probably damaging Het
Btbd11 C A 10: 85,645,578 T948K probably damaging Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dnah17 T A 11: 118,074,023 N2365Y probably damaging Het
Dnah7a T A 1: 53,647,236 probably benign Het
Dnajc16 G T 4: 141,767,741 S520* probably null Het
Dsg1b G T 18: 20,397,430 E381* probably null Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Endou A T 15: 97,718,973 probably benign Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fat4 T C 3: 38,890,813 I1285T probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm13083 T A 4: 143,616,034 I237K probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gnas C T 2: 174,345,214 probably benign Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Hsd17b4 G T 18: 50,130,187 probably benign Het
Kmt2b A G 7: 30,576,960 probably benign Het
Lrch1 T C 14: 74,804,269 probably benign Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mtch2 A T 2: 90,853,015 probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Mug1 C T 6: 121,838,676 S13L probably benign Het
Naa25 T G 5: 121,423,734 L450R probably damaging Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nrp2 C T 1: 62,783,332 R695* probably null Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr373 T C 8: 72,100,387 L209P probably damaging Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Pclo A T 5: 14,678,130 probably benign Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Pkn3 T A 2: 30,083,047 V323E probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plppr2 C T 9: 21,947,789 P401S possibly damaging Het
Poln A G 5: 34,078,975 V604A probably benign Het
Prkd2 A G 7: 16,869,545 D800G probably benign Het
Ptprb A G 10: 116,319,470 T710A probably benign Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Ralbp1 A T 17: 65,859,148 probably benign Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Smcr8 T C 11: 60,778,032 I2T probably damaging Het
Smtnl2 T C 11: 72,401,421 T301A probably damaging Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Szt2 A T 4: 118,387,779 S1187T probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tfap2a T A 13: 40,717,204 M405L possibly damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tmem132b C A 5: 125,638,249 Q341K probably benign Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Utrn C T 10: 12,713,350 V871I probably benign Het
Vat1l T C 8: 114,282,361 probably benign Het
Vmn1r205 T C 13: 22,592,879 K18E probably benign Het
Zfp518a T A 19: 40,914,359 Y911N probably damaging Het
Zfyve28 A G 5: 34,217,246 C475R probably damaging Het
Other mutations in Epn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Epn2 APN 11 61523086 missense probably benign 0.00
IGL01582:Epn2 APN 11 61521869 missense probably benign 0.00
IGL02375:Epn2 APN 11 61519671 missense probably damaging 1.00
IGL03213:Epn2 APN 11 61519684 missense probably damaging 0.99
Ipanema UTSW 11 61519558 missense probably benign 0.00
R0400:Epn2 UTSW 11 61532696 splice site probably null
R0458:Epn2 UTSW 11 61546455 missense possibly damaging 0.89
R0471:Epn2 UTSW 11 61535308 missense probably damaging 1.00
R0833:Epn2 UTSW 11 61519491 missense probably benign 0.01
R0836:Epn2 UTSW 11 61519491 missense probably benign 0.01
R1699:Epn2 UTSW 11 61523188 nonsense probably null
R1743:Epn2 UTSW 11 61546411 missense possibly damaging 0.92
R4039:Epn2 UTSW 11 61546522 missense probably damaging 1.00
R4696:Epn2 UTSW 11 61535303 missense probably damaging 1.00
R4752:Epn2 UTSW 11 61546371 missense probably damaging 1.00
R4913:Epn2 UTSW 11 61534576 critical splice donor site probably null
R6053:Epn2 UTSW 11 61546497 missense probably damaging 1.00
R6302:Epn2 UTSW 11 61546486 missense probably damaging 1.00
R6455:Epn2 UTSW 11 61533641 missense probably damaging 1.00
R6669:Epn2 UTSW 11 61519558 missense probably benign 0.00
R7032:Epn2 UTSW 11 61546702 missense probably damaging 1.00
R7439:Epn2 UTSW 11 61546848 start gained probably benign
R8008:Epn2 UTSW 11 61546666 missense probably damaging 1.00
Z1177:Epn2 UTSW 11 61546424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTTGGGACCCAATGCAGCAC -3'
(R):5'- GCAGCCTATGGACTCTAACTTTGCC -3'

Sequencing Primer
(F):5'- CATACATAAGGGCCTGTGATGC -3'
(R):5'- tgtgtgaggctatgtgagttg -3'
Posted On2014-03-14