Incidental Mutation 'R1418:Asap2'
ID159944
Institutional Source Beutler Lab
Gene Symbol Asap2
Ensembl Gene ENSMUSG00000052632
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms6530401G17Rik, LOC385250, Ddef2
MMRRC Submission 039474-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R1418 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location20990459-21270171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21239585 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 501 (N501H)
Ref Sequence ENSEMBL: ENSMUSP00000099098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]
Predicted Effect probably damaging
Transcript: ENSMUST00000050990
AA Change: N498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: N498H

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
SH3 896 954 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064595
AA Change: N498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: N498H

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090834
AA Change: N352H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: N352H

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101562
AA Change: N501H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: N501H

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172962
Meta Mutation Damage Score 0.7806 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 97% (92/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Alb A G 5: 90,464,202 probably benign Het
Arnt A G 3: 95,470,399 probably benign Het
Atp5b C T 10: 128,083,298 probably benign Het
Atrnl1 G A 19: 57,935,705 probably null Het
AW554918 T G 18: 25,339,699 probably null Het
Bod1l G A 5: 41,819,471 T1500I probably damaging Het
Btbd11 C A 10: 85,645,578 T948K probably damaging Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dnah17 T A 11: 118,074,023 N2365Y probably damaging Het
Dnah7a T A 1: 53,647,236 probably benign Het
Dnajc16 G T 4: 141,767,741 S520* probably null Het
Dsg1b G T 18: 20,397,430 E381* probably null Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Endou A T 15: 97,718,973 probably benign Het
Epn2 A G 11: 61,523,086 S419P probably benign Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fat4 T C 3: 38,890,813 I1285T probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm13083 T A 4: 143,616,034 I237K probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gnas C T 2: 174,345,214 probably benign Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Hsd17b4 G T 18: 50,130,187 probably benign Het
Kmt2b A G 7: 30,576,960 probably benign Het
Lrch1 T C 14: 74,804,269 probably benign Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mtch2 A T 2: 90,853,015 probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Mug1 C T 6: 121,838,676 S13L probably benign Het
Naa25 T G 5: 121,423,734 L450R probably damaging Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nrp2 C T 1: 62,783,332 R695* probably null Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr373 T C 8: 72,100,387 L209P probably damaging Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Pclo A T 5: 14,678,130 probably benign Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Pkn3 T A 2: 30,083,047 V323E probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plppr2 C T 9: 21,947,789 P401S possibly damaging Het
Poln A G 5: 34,078,975 V604A probably benign Het
Prkd2 A G 7: 16,869,545 D800G probably benign Het
Ptprb A G 10: 116,319,470 T710A probably benign Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Ralbp1 A T 17: 65,859,148 probably benign Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Smcr8 T C 11: 60,778,032 I2T probably damaging Het
Smtnl2 T C 11: 72,401,421 T301A probably damaging Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Szt2 A T 4: 118,387,779 S1187T probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tfap2a T A 13: 40,717,204 M405L possibly damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tmem132b C A 5: 125,638,249 Q341K probably benign Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Utrn C T 10: 12,713,350 V871I probably benign Het
Vat1l T C 8: 114,282,361 probably benign Het
Vmn1r205 T C 13: 22,592,879 K18E probably benign Het
Zfp518a T A 19: 40,914,359 Y911N probably damaging Het
Zfyve28 A G 5: 34,217,246 C475R probably damaging Het
Other mutations in Asap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Asap2 APN 12 21239648 missense possibly damaging 0.66
IGL01140:Asap2 APN 12 21206316 missense probably damaging 1.00
IGL01285:Asap2 APN 12 21229263 missense probably damaging 1.00
IGL01318:Asap2 APN 12 21247295 missense probably null 0.00
IGL01355:Asap2 APN 12 21218086 splice site probably benign
IGL01593:Asap2 APN 12 21213202 missense probably null 0.03
IGL01705:Asap2 APN 12 21249368 missense possibly damaging 0.85
IGL01716:Asap2 APN 12 21254306 missense possibly damaging 0.94
IGL02822:Asap2 APN 12 21265910 missense probably damaging 1.00
IGL02876:Asap2 APN 12 21258163 missense probably benign 0.00
IGL02991:Asap2 APN 12 21249293 splice site probably benign
R0157:Asap2 UTSW 12 21206325 missense probably damaging 1.00
R0399:Asap2 UTSW 12 21217997 missense possibly damaging 0.90
R0472:Asap2 UTSW 12 21213185 missense possibly damaging 0.47
R0959:Asap2 UTSW 12 21247319 missense probably damaging 1.00
R0981:Asap2 UTSW 12 21265960 missense probably damaging 0.98
R1141:Asap2 UTSW 12 21185110 missense probably damaging 1.00
R1382:Asap2 UTSW 12 21265954 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239589 missense probably damaging 1.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1526:Asap2 UTSW 12 21185187 missense probably damaging 1.00
R1542:Asap2 UTSW 12 21265997 missense probably damaging 1.00
R1710:Asap2 UTSW 12 21224392 missense probably damaging 1.00
R1750:Asap2 UTSW 12 21203998 missense probably damaging 1.00
R2151:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2152:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2154:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2323:Asap2 UTSW 12 21203968 missense probably damaging 1.00
R2378:Asap2 UTSW 12 21254318 missense possibly damaging 0.95
R3151:Asap2 UTSW 12 21224377 missense probably damaging 1.00
R3757:Asap2 UTSW 12 21267766 missense probably damaging 1.00
R4305:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4307:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4308:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4345:Asap2 UTSW 12 21230831 missense probably damaging 1.00
R4525:Asap2 UTSW 12 21229292 splice site probably null
R4562:Asap2 UTSW 12 21112093 missense probably damaging 1.00
R4999:Asap2 UTSW 12 21252765 missense probably benign 0.19
R5027:Asap2 UTSW 12 21204081 missense probably damaging 1.00
R5221:Asap2 UTSW 12 21213190 missense probably benign 0.14
R5645:Asap2 UTSW 12 21265982 missense probably damaging 0.99
R5799:Asap2 UTSW 12 21168246 missense probably damaging 1.00
R5876:Asap2 UTSW 12 21212809 missense possibly damaging 0.88
R5888:Asap2 UTSW 12 21218190 missense probably damaging 1.00
R5912:Asap2 UTSW 12 21206343 missense probably damaging 1.00
R6576:Asap2 UTSW 12 21244703 missense probably damaging 1.00
R6896:Asap2 UTSW 12 21265525 missense probably damaging 1.00
R6934:Asap2 UTSW 12 21168250 missense probably damaging 1.00
R7134:Asap2 UTSW 12 21265963 nonsense probably null
R7347:Asap2 UTSW 12 21229457 missense probably benign 0.03
R7515:Asap2 UTSW 12 21229239 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GCTTCTCCAAGTCTGTGGTGACTG -3'
(R):5'- GGACACTGGCACTAGGAATGATGC -3'

Sequencing Primer
(F):5'- GGCGTCCATTTCCCACAG -3'
(R):5'- CTGGGCACAATTCACCATGTTAG -3'
Posted On2014-03-14