Incidental Mutation 'R1418:Atrnl1'
ID159971
Institutional Source Beutler Lab
Gene Symbol Atrnl1
Ensembl Gene ENSMUSG00000054843
Gene Nameattractin like 1
SynonymsAlp
MMRRC Submission 039474-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R1418 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location57611034-58133338 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 57935705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077282]
Predicted Effect probably null
Transcript: ENSMUST00000077282
SMART Domains Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
EGF 61 90 5.71e-1 SMART
CUB 92 208 1.43e-11 SMART
EGF 209 244 1.95e1 SMART
Pfam:EGF_2 248 279 5.8e-7 PFAM
Pfam:Kelch_5 350 391 2.1e-9 PFAM
Pfam:Kelch_6 354 401 5.8e-8 PFAM
Pfam:Kelch_4 465 517 4.3e-7 PFAM
Pfam:Kelch_1 519 573 2.7e-6 PFAM
PSI 613 656 3.38e-1 SMART
PSI 665 708 2e-3 SMART
PSI 714 759 1.72e-2 SMART
CLECT 747 872 2.86e-20 SMART
PSI 888 938 6.26e-5 SMART
PSI 941 1011 1.73e-7 SMART
EGF_Lam 1013 1056 1.07e-5 SMART
low complexity region 1157 1173 N/A INTRINSIC
transmembrane domain 1229 1251 N/A INTRINSIC
low complexity region 1261 1272 N/A INTRINSIC
low complexity region 1326 1339 N/A INTRINSIC
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 97% (92/95)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Alb A G 5: 90,464,202 probably benign Het
Arnt A G 3: 95,470,399 probably benign Het
Asap2 A C 12: 21,239,585 N501H probably damaging Het
Asap2 A G 12: 21,239,589 E499G probably damaging Het
Atp5b C T 10: 128,083,298 probably benign Het
AW554918 T G 18: 25,339,699 probably null Het
Bod1l G A 5: 41,819,471 T1500I probably damaging Het
Btbd11 C A 10: 85,645,578 T948K probably damaging Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dnah17 T A 11: 118,074,023 N2365Y probably damaging Het
Dnah7a T A 1: 53,647,236 probably benign Het
Dnajc16 G T 4: 141,767,741 S520* probably null Het
Dsg1b G T 18: 20,397,430 E381* probably null Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Endou A T 15: 97,718,973 probably benign Het
Epn2 A G 11: 61,523,086 S419P probably benign Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fat4 T C 3: 38,890,813 I1285T probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm13083 T A 4: 143,616,034 I237K probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gnas C T 2: 174,345,214 probably benign Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Hsd17b4 G T 18: 50,130,187 probably benign Het
Kmt2b A G 7: 30,576,960 probably benign Het
Lrch1 T C 14: 74,804,269 probably benign Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mtch2 A T 2: 90,853,015 probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Mug1 C T 6: 121,838,676 S13L probably benign Het
Naa25 T G 5: 121,423,734 L450R probably damaging Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nrp2 C T 1: 62,783,332 R695* probably null Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr373 T C 8: 72,100,387 L209P probably damaging Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Pclo A T 5: 14,678,130 probably benign Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Pkn3 T A 2: 30,083,047 V323E probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plppr2 C T 9: 21,947,789 P401S possibly damaging Het
Poln A G 5: 34,078,975 V604A probably benign Het
Prkd2 A G 7: 16,869,545 D800G probably benign Het
Ptprb A G 10: 116,319,470 T710A probably benign Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Ralbp1 A T 17: 65,859,148 probably benign Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Smcr8 T C 11: 60,778,032 I2T probably damaging Het
Smtnl2 T C 11: 72,401,421 T301A probably damaging Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Szt2 A T 4: 118,387,779 S1187T probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tfap2a T A 13: 40,717,204 M405L possibly damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tmem132b C A 5: 125,638,249 Q341K probably benign Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Utrn C T 10: 12,713,350 V871I probably benign Het
Vat1l T C 8: 114,282,361 probably benign Het
Vmn1r205 T C 13: 22,592,879 K18E probably benign Het
Zfp518a T A 19: 40,914,359 Y911N probably damaging Het
Zfyve28 A G 5: 34,217,246 C475R probably damaging Het
Other mutations in Atrnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Atrnl1 APN 19 57691817 missense probably benign 0.02
IGL00707:Atrnl1 APN 19 57673265 missense probably damaging 0.96
IGL00921:Atrnl1 APN 19 57702153 missense probably damaging 1.00
IGL01410:Atrnl1 APN 19 58131104 missense probably damaging 1.00
IGL01468:Atrnl1 APN 19 57699712 missense probably benign 0.02
IGL01756:Atrnl1 APN 19 57652948 missense probably benign
IGL01971:Atrnl1 APN 19 57753283 missense probably damaging 1.00
IGL02019:Atrnl1 APN 19 57691763 splice site probably benign
IGL02580:Atrnl1 APN 19 57714576 splice site probably benign
IGL02649:Atrnl1 APN 19 57650441 splice site probably benign
IGL02676:Atrnl1 APN 19 57691884 missense probably damaging 1.00
IGL03276:Atrnl1 APN 19 57652927 missense probably damaging 0.99
IGL03379:Atrnl1 APN 19 57642541 missense probably benign 0.02
Magnetogorsk UTSW 19 57630306 missense probably damaging 1.00
polar UTSW 19 57652950 missense probably benign 0.00
PIT4812001:Atrnl1 UTSW 19 57731623 missense probably benign 0.08
R0109:Atrnl1 UTSW 19 57755517 missense possibly damaging 0.78
R0308:Atrnl1 UTSW 19 57753288 missense probably benign 0.04
R0394:Atrnl1 UTSW 19 57673176 missense probably benign 0.10
R0734:Atrnl1 UTSW 19 57654861 missense probably damaging 1.00
R0811:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R0812:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R1183:Atrnl1 UTSW 19 57650293 missense probably damaging 0.97
R1213:Atrnl1 UTSW 19 57638462 missense probably benign 0.25
R1344:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1707:Atrnl1 UTSW 19 57686737 missense probably benign 0.00
R1748:Atrnl1 UTSW 19 57714702 missense probably damaging 0.99
R2051:Atrnl1 UTSW 19 57691849 missense probably benign 0.01
R2113:Atrnl1 UTSW 19 57755616 nonsense probably null
R2130:Atrnl1 UTSW 19 57654994 missense probably damaging 1.00
R3710:Atrnl1 UTSW 19 57657114 missense probably damaging 1.00
R3916:Atrnl1 UTSW 19 57935652 missense possibly damaging 0.82
R4524:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R4707:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4712:Atrnl1 UTSW 19 57652950 missense probably benign 0.00
R4784:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4785:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4798:Atrnl1 UTSW 19 58042361 missense probably benign
R5172:Atrnl1 UTSW 19 57685513 nonsense probably null
R5226:Atrnl1 UTSW 19 57650335 missense probably benign
R5289:Atrnl1 UTSW 19 57657082 missense probably damaging 1.00
R5372:Atrnl1 UTSW 19 57755536 missense probably benign
R5737:Atrnl1 UTSW 19 57777888 missense possibly damaging 0.84
R5782:Atrnl1 UTSW 19 57753286 missense possibly damaging 0.95
R5826:Atrnl1 UTSW 19 57630292 nonsense probably null
R6169:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
R6242:Atrnl1 UTSW 19 57642478 missense probably benign 0.02
R6342:Atrnl1 UTSW 19 57638510 missense probably damaging 1.00
R6372:Atrnl1 UTSW 19 57650332 missense probably benign 0.01
R6811:Atrnl1 UTSW 19 57654961 missense probably damaging 0.98
R6897:Atrnl1 UTSW 19 58042368 missense probably benign 0.01
R7024:Atrnl1 UTSW 19 57638450 critical splice acceptor site probably null
R7085:Atrnl1 UTSW 19 57691857 missense probably damaging 1.00
R7144:Atrnl1 UTSW 19 58042352 missense probably damaging 1.00
R7259:Atrnl1 UTSW 19 57935606 nonsense probably null
R7289:Atrnl1 UTSW 19 57650414 missense probably benign 0.13
R7310:Atrnl1 UTSW 19 57642424 missense possibly damaging 0.69
R7372:Atrnl1 UTSW 19 57935646 missense possibly damaging 0.47
R7432:Atrnl1 UTSW 19 57755524 missense probably damaging 1.00
R7478:Atrnl1 UTSW 19 57696312 missense possibly damaging 0.89
R7556:Atrnl1 UTSW 19 57654846 missense probably benign
R7567:Atrnl1 UTSW 19 57699523 missense probably damaging 0.98
R7608:Atrnl1 UTSW 19 57714687 missense probably damaging 1.00
R7632:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R7655:Atrnl1 UTSW 19 57611379 nonsense probably null
R7656:Atrnl1 UTSW 19 57611379 nonsense probably null
R7718:Atrnl1 UTSW 19 57740183 nonsense probably null
R7721:Atrnl1 UTSW 19 57696331 missense probably benign 0.00
R7726:Atrnl1 UTSW 19 57702072 missense probably damaging 1.00
R7733:Atrnl1 UTSW 19 57701988 missense probably benign 0.00
R7774:Atrnl1 UTSW 19 57699671 missense probably damaging 1.00
R8010:Atrnl1 UTSW 19 57682446 missense probably benign 0.14
R8119:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
RF021:Atrnl1 UTSW 19 57642473 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTAGCACCTTGCACCTGAGATCC -3'
(R):5'- TGTTGTAGCTCGTGCCTTACCG -3'

Sequencing Primer
(F):5'- TTTGTCAGTGAAGTTGAACCAG -3'
(R):5'- CCGTTAAATCTATGTGCCTTGGAAG -3'
Posted On2014-03-14