Incidental Mutation 'R1419:Olfr1042'
ID159974
Institutional Source Beutler Lab
Gene Symbol Olfr1042
Ensembl Gene ENSMUSG00000075202
Gene Nameolfactory receptor 1042
SynonymsMOR185-10, GA_x6K02T2Q125-47629317-47628376
MMRRC Submission 039475-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1419 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86156743-86161838 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 86159429 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 314 (*314Q)
Ref Sequence ENSEMBL: ENSMUSP00000151053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099907] [ENSMUST00000099908] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215624] [ENSMUST00000216028]
Predicted Effect probably benign
Transcript: ENSMUST00000099907
SMART Domains Protein: ENSMUSP00000097491
Gene: ENSMUSG00000075201

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.9e-46 PFAM
Pfam:7tm_1 41 290 1.5e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099908
AA Change: *314Q
SMART Domains Protein: ENSMUSP00000097492
Gene: ENSMUSG00000075202
AA Change: *314Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213886
Predicted Effect probably benign
Transcript: ENSMUST00000213949
Predicted Effect probably null
Transcript: ENSMUST00000215624
AA Change: *314Q
Predicted Effect probably benign
Transcript: ENSMUST00000216028
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,374,902 M894K probably benign Het
Ablim1 C A 19: 57,134,633 C173F probably damaging Het
Abtb2 G T 2: 103,709,420 R710L probably benign Het
AI481877 T C 4: 59,064,457 T826A possibly damaging Het
Arap3 T C 18: 37,978,432 T1144A possibly damaging Het
Arhgef12 A T 9: 43,027,220 V92D probably damaging Het
Ash1l T G 3: 88,984,897 M1361R probably damaging Het
Atm A C 9: 53,457,489 N2337K probably benign Het
Cog7 T C 7: 121,955,992 E316G probably damaging Het
Dsp A G 13: 38,186,695 Y858C probably damaging Het
Enc1 G T 13: 97,246,184 G401C probably damaging Het
Gata6 T C 18: 11,064,706 V506A probably benign Het
Gm16380 C T 9: 53,884,187 noncoding transcript Het
H2-Ke6 G A 17: 34,027,643 R89C probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift80 T A 3: 68,940,198 N322Y probably damaging Het
Igsf9 T A 1: 172,498,011 V1082E probably damaging Het
Katnal2 A T 18: 76,977,432 L481Q possibly damaging Het
Kcnma1 T C 14: 23,367,642 T713A probably damaging Het
Kif13a T C 13: 46,825,235 T230A probably damaging Het
Klhl14 C A 18: 21,652,193 R59L probably damaging Het
Mecom A G 3: 29,980,889 C213R probably damaging Het
Mrpl13 T A 15: 55,534,321 M178L probably benign Het
Myof T C 19: 37,901,911 E1971G probably damaging Het
Naa10 A G X: 73,917,916 V133A probably damaging Het
Nlrp4g G A 9: 124,349,434 noncoding transcript Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1234 T C 2: 89,363,322 T36A probably damaging Het
Olfr1297 A T 2: 111,621,295 F260I probably benign Het
Oplah T C 15: 76,297,920 I1047V probably benign Het
Paip1 A G 13: 119,457,017 D189G probably damaging Het
Pkn1 A G 8: 83,673,522 F624L probably damaging Het
Plxnb1 C A 9: 109,114,386 P1899H probably damaging Het
Rpa3 T A 6: 8,257,720 E47D probably benign Het
Snai2 C T 16: 14,708,180 H232Y possibly damaging Het
Spint5 T C 2: 164,715,411 S23P possibly damaging Het
St8sia2 G A 7: 73,966,994 Q78* probably null Het
Tktl2 A G 8: 66,513,038 N416S probably damaging Het
Tm7sf3 T A 6: 146,603,977 I494F possibly damaging Het
Trf C T 9: 103,226,108 V119M probably damaging Het
Other mutations in Olfr1042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Olfr1042 APN 2 86160047 missense probably benign 0.04
IGL02071:Olfr1042 APN 2 86159875 missense probably benign
IGL02935:Olfr1042 APN 2 86160370 unclassified probably benign
IGL03152:Olfr1042 APN 2 86159686 missense possibly damaging 0.95
R0089:Olfr1042 UTSW 2 86159574 missense possibly damaging 0.89
R1699:Olfr1042 UTSW 2 86159936 missense probably benign
R1804:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3609:Olfr1042 UTSW 2 86159632 missense probably benign 0.00
R3953:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3955:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3956:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3957:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R4771:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R5685:Olfr1042 UTSW 2 86159795 missense probably damaging 0.99
R6241:Olfr1042 UTSW 2 86160036 missense probably damaging 1.00
R6324:Olfr1042 UTSW 2 86159456 missense probably benign
R6678:Olfr1042 UTSW 2 86160185 missense probably damaging 0.98
R6921:Olfr1042 UTSW 2 86159852 missense probably benign 0.02
R7215:Olfr1042 UTSW 2 86159456 missense probably benign
R7386:Olfr1042 UTSW 2 86159530 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGGTACTCCAATGGTCTGGTCTGG -3'
(R):5'- TGCAGCCCAAGTCAAGTCATTCTC -3'

Sequencing Primer
(F):5'- GCATTCAGTTTCACAGAGCC -3'
(R):5'- GTCAAGTCATTCTCTGAACACAG -3'
Posted On2014-03-14