Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Ift80'

159981

Institutional Source

Beutler Lab

Gene Symbol

Ift80

Ensembl Gene

ENSMUSG00000027778

Gene Name

intraflagellar transport 80

Synonyms

4921524P20Rik, Wdr56

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R1419 (G1)

Quality Score

167

Status

Not validated

Chromosome

Chromosomal Location

68892499-69004570 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68940198 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 322 (N322Y)

Ref Sequence

ENSEMBL: ENSMUSP00000133263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000169064]

AlphaFold

Q8K057

Predicted Effect

probably damaging
Transcript: ENSMUST00000029347
AA Change: N322Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: N322Y

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107812
AA Change: N322Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: N322Y

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152502

Predicted Effect

probably damaging
Transcript: ENSMUST00000169064
AA Change: N322Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: N322Y

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176754

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Ift80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Ift80	APN	3	68914653	nonsense	probably null
IGL01020:Ift80	APN	3	68963679	missense	probably damaging	1.00
IGL01544:Ift80	APN	3	68990782	missense	probably benign	0.05
IGL01612:Ift80	APN	3	68963663	missense	possibly damaging	0.61
IGL01743:Ift80	APN	3	68962296	missense	probably benign	0.00
IGL02187:Ift80	APN	3	68985456	missense	probably damaging	1.00
IGL02381:Ift80	APN	3	68962320	splice site	probably null
IGL02407:Ift80	APN	3	68898536	missense	probably benign
IGL02510:Ift80	APN	3	68898543	missense	probably benign	0.07
IGL02512:Ift80	APN	3	68927725	critical splice donor site	probably null
R0091:Ift80	UTSW	3	68914675	missense	probably damaging	1.00
R0212:Ift80	UTSW	3	68940173	missense	probably benign	0.05
R0348:Ift80	UTSW	3	68935899	missense	probably benign
R0357:Ift80	UTSW	3	68914653	nonsense	probably null
R1381:Ift80	UTSW	3	68914783	missense	possibly damaging	0.78
R1643:Ift80	UTSW	3	68916157	missense	probably benign	0.06
R1899:Ift80	UTSW	3	68918513	missense	probably benign	0.00
R1926:Ift80	UTSW	3	68916165	missense	probably damaging	1.00
R2013:Ift80	UTSW	3	68990784	missense	possibly damaging	0.62
R3894:Ift80	UTSW	3	68917999	missense	probably damaging	1.00
R4214:Ift80	UTSW	3	68990808	missense	possibly damaging	0.64
R4290:Ift80	UTSW	3	68963690	missense	probably damaging	0.96
R4303:Ift80	UTSW	3	68894174	missense	probably benign	0.15
R4361:Ift80	UTSW	3	68963649	missense	probably damaging	1.00
R4576:Ift80	UTSW	3	68950530	missense	possibly damaging	0.71
R4596:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4652:Ift80	UTSW	3	68914940	missense	probably benign	0.32
R4654:Ift80	UTSW	3	68918537	missense	possibly damaging	0.94
R4720:Ift80	UTSW	3	68962290	missense	possibly damaging	0.50
R4865:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4885:Ift80	UTSW	3	68950496	missense	probably damaging	0.98
R5357:Ift80	UTSW	3	68990780	missense	possibly damaging	0.62
R5561:Ift80	UTSW	3	68967863	missense	probably benign	0.00
R5589:Ift80	UTSW	3	68930900	missense	probably damaging	1.00
R5806:Ift80	UTSW	3	68950476	missense	probably benign	0.09
R6910:Ift80	UTSW	3	68927735	missense	probably benign	0.01
R6962:Ift80	UTSW	3	68994545	start gained	probably benign
R7157:Ift80	UTSW	3	68990944	nonsense	probably null
R7452:Ift80	UTSW	3	68994282	splice site	probably null
R7504:Ift80	UTSW	3	68918005	missense	probably damaging	0.99
R8077:Ift80	UTSW	3	68916145	missense	probably benign	0.01
R8435:Ift80	UTSW	3	68985454	missense	probably damaging	1.00
R8821:Ift80	UTSW	3	68962250	missense	probably damaging	0.98
R8831:Ift80	UTSW	3	68962250	missense	probably damaging	0.98
R8897:Ift80	UTSW	3	68950476	missense	probably benign
R9222:Ift80	UTSW	3	68918561	missense	possibly damaging	0.58
R9328:Ift80	UTSW	3	68940150	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCTGGACTTTGACTTACGACTC -3'
(R):5'- CGCTTGGCTTGGCATGAAGATG -3'

Sequencing Primer
(F):5'- AGTCTTCCCTCCTATGTAAGGAAAC -3'
(R):5'- GAGCACATTGAATTTTTCCTGCA -3'

Posted On

2014-03-14