Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:AI481877'

159983

Institutional Source

Beutler Lab

Gene Symbol

AI481877

Ensembl Gene

ENSMUSG00000038598

Gene Name

expressed sequence AI481877

Synonyms

LOC242489, Gm426

MMRRC Submission

039475-MU

Accession Numbers

Genbank: XM_001476641.2; Ensembl: ENSMUST00000107547

Essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59043753-59138983 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59064457 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 826 (T826A)

Ref Sequence

ENSEMBL: ENSMUSP00000103171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107547]

AlphaFold

A2ALV5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107547
AA Change: T826A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: T826A

Domain	Start	End	E-Value	Type
low complexity region	246	264	N/A	INTRINSIC
low complexity region	543	560	N/A	INTRINSIC
low complexity region	908	917	N/A	INTRINSIC
low complexity region	1189	1201	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in AI481877

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:AI481877	APN	4	59086961	missense	probably benign
IGL00574:AI481877	APN	4	59094201	missense	possibly damaging	0.66
IGL01333:AI481877	APN	4	59047870	missense	possibly damaging	0.66
IGL02282:AI481877	APN	4	59111114	missense	unknown
IGL02418:AI481877	APN	4	59049075	splice site	probably benign
IGL02621:AI481877	APN	4	59062668	missense	probably damaging	0.97
IGL03028:AI481877	APN	4	59094274	missense	possibly damaging	0.66
IGL03112:AI481877	APN	4	59049355	missense	probably benign	0.27
IGL03137:AI481877	APN	4	59094162	missense	probably benign	0.27
IGL03220:AI481877	APN	4	59082378	nonsense	probably null
IGL03386:AI481877	APN	4	59069315	missense	possibly damaging	0.66
1mM(1):AI481877	UTSW	4	59048024	nonsense	probably null
R0071:AI481877	UTSW	4	59059643	missense	possibly damaging	0.92
R0071:AI481877	UTSW	4	59059643	missense	possibly damaging	0.92
R0194:AI481877	UTSW	4	59066534	splice site	probably benign
R0366:AI481877	UTSW	4	59099410	missense	probably benign	0.09
R0680:AI481877	UTSW	4	59043967	missense	probably benign	0.00
R1599:AI481877	UTSW	4	59072349	missense	possibly damaging	0.82
R1699:AI481877	UTSW	4	59113926	missense	unknown
R1799:AI481877	UTSW	4	59099383	missense	possibly damaging	0.92
R1832:AI481877	UTSW	4	59066441	missense	probably benign	0.05
R1870:AI481877	UTSW	4	59054142	splice site	probably benign
R2076:AI481877	UTSW	4	59082410	missense	possibly damaging	0.46
R2170:AI481877	UTSW	4	59069215	missense	possibly damaging	0.92
R2870:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2870:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2871:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2871:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2872:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2872:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R2873:AI481877	UTSW	4	59093850	missense	probably damaging	0.97
R3026:AI481877	UTSW	4	59062656	missense	possibly damaging	0.83
R3079:AI481877	UTSW	4	59047848	missense	possibly damaging	0.82
R3853:AI481877	UTSW	4	59047390	missense	possibly damaging	0.66
R3914:AI481877	UTSW	4	59094201	missense	possibly damaging	0.66
R4006:AI481877	UTSW	4	59076500	missense	possibly damaging	0.53
R4364:AI481877	UTSW	4	59082294	missense	possibly damaging	0.92
R4387:AI481877	UTSW	4	59060915	missense	possibly damaging	0.66
R4454:AI481877	UTSW	4	59092383	missense	possibly damaging	0.90
R4811:AI481877	UTSW	4	59082404	missense	probably benign	0.19
R4853:AI481877	UTSW	4	59072345	missense	possibly damaging	0.66
R4899:AI481877	UTSW	4	59062640	missense	probably damaging	0.97
R5090:AI481877	UTSW	4	59111108	missense	unknown
R5169:AI481877	UTSW	4	59059618	missense	possibly damaging	0.66
R5297:AI481877	UTSW	4	59047543	missense	probably benign
R5400:AI481877	UTSW	4	59082432	missense	possibly damaging	0.83
R5419:AI481877	UTSW	4	59049017	missense	probably benign	0.04
R5668:AI481877	UTSW	4	59047399	missense	probably benign
R5770:AI481877	UTSW	4	59092466	missense	probably benign	0.00
R5783:AI481877	UTSW	4	59076239	nonsense	probably null
R5929:AI481877	UTSW	4	59092497	nonsense	probably null
R6209:AI481877	UTSW	4	59043869	makesense	probably null
R6230:AI481877	UTSW	4	59099345	missense	probably benign
R6233:AI481877	UTSW	4	59076245	missense	possibly damaging	0.92
R6351:AI481877	UTSW	4	59069317	missense	probably benign	0.00
R6785:AI481877	UTSW	4	59049066	missense	probably benign	0.01
R6884:AI481877	UTSW	4	59059652	missense	possibly damaging	0.83
R7355:AI481877	UTSW	4	59076155	missense	probably benign
R7423:AI481877	UTSW	4	59076264	missense	probably benign	0.27
R7484:AI481877	UTSW	4	59062286	missense	probably damaging	0.97
R7560:AI481877	UTSW	4	59076140	missense	possibly damaging	0.66
R7999:AI481877	UTSW	4	59094162	missense	probably benign	0.27
R8198:AI481877	UTSW	4	59065174	missense	probably benign	0.10
R8979:AI481877	UTSW	4	59047276	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- TGTGAGCTACAGCCACAGCCA -3'
(R):5'- CTCCAGTTGCTCAAATGTTCATCAGGA -3'

Sequencing Primer
(F):5'- TCTTCCTGTGGAACTATGCC -3'
(R):5'- GGAGATGGGATTTAACCCGGTTT -3'

Posted On

2014-03-14