Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Tm7sf3'

159987

Institutional Source

Beutler Lab

Gene Symbol

Tm7sf3

Ensembl Gene

ENSMUSG00000040234

Gene Name

transmembrane 7 superfamily member 3

Synonyms

2010003B14Rik

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146602352-146642824 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 146603977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 494 (I494F)

Ref Sequence

ENSEMBL: ENSMUSP00000045650 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037709] [ENSMUST00000067404] [ENSMUST00000111663]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037709
AA Change: I494F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000045650
Gene: ENSMUSG00000040234
AA Change: I494F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:DUF4203	291	498	8.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000067404

SMART Domains

Protein: ENSMUSP00000098352
Gene: ENSMUSG00000040242

Domain	Start	End	E-Value	Type
Pfam:DUF837	1	185	8.6e-80	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111663

SMART Domains

Protein: ENSMUSP00000107292
Gene: ENSMUSG00000040242

Domain	Start	End	E-Value	Type
Pfam:DUF837	2	221	2e-73	PFAM

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Tm7sf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Tm7sf3	APN	6	146606194	missense	possibly damaging	0.51
IGL01930:Tm7sf3	APN	6	146610933	missense	possibly damaging	0.71
IGL02073:Tm7sf3	APN	6	146623710	missense	possibly damaging	0.96
IGL02720:Tm7sf3	APN	6	146613374	splice site	probably benign
IGL02815:Tm7sf3	APN	6	146613473	splice site	probably null
IGL03255:Tm7sf3	APN	6	146606120	unclassified	probably benign
R0245:Tm7sf3	UTSW	6	146618609	missense	possibly damaging	0.53
R0402:Tm7sf3	UTSW	6	146606187	missense	possibly damaging	0.95
R0687:Tm7sf3	UTSW	6	146621890	missense	possibly damaging	0.96
R0763:Tm7sf3	UTSW	6	146606289	missense	possibly damaging	0.93
R1511:Tm7sf3	UTSW	6	146609878	missense	probably benign	0.05
R4880:Tm7sf3	UTSW	6	146609860	missense	possibly damaging	0.93
R5930:Tm7sf3	UTSW	6	146603911	missense	possibly damaging	0.53
R6160:Tm7sf3	UTSW	6	146606289	nonsense	probably null
R6229:Tm7sf3	UTSW	6	146613389	missense	possibly damaging	0.71
R6755:Tm7sf3	UTSW	6	146609973	splice site	probably null
R6912:Tm7sf3	UTSW	6	146626103	missense	possibly damaging	0.91
R6920:Tm7sf3	UTSW	6	146606147	missense	possibly damaging	0.71
R8913:Tm7sf3	UTSW	6	146626123	nonsense	probably null
R9364:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9365:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9367:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9371:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9372:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9396:Tm7sf3	UTSW	6	146621974	missense	possibly damaging	0.53
R9447:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9449:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9450:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9451:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9454:Tm7sf3	UTSW	6	146618543	missense	probably benign	0.00
R9495:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9496:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9497:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9514:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9516:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9551:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9552:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9553:Tm7sf3	UTSW	6	146623681	missense	possibly damaging	0.85
R9576:Tm7sf3	UTSW	6	146609837	missense	probably damaging	1.00
R9652:Tm7sf3	UTSW	6	146626200	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTTTGATCCGAGCAACCCGAC -3'
(R):5'- ctccacacacaccacacaAAAACTG -3'

Sequencing Primer
(F):5'- GACCATAAAGCCTCTCTCTCAGG -3'
(R):5'- ttggtattcaatagaaggcaggagg -3'

Posted On

2014-03-14