Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Cog7'

159990

Institutional Source

Beutler Lab

Gene Symbol

Cog7

Ensembl Gene

ENSMUSG00000034951

Gene Name

component of oligomeric golgi complex 7

Synonyms

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121879363-121981711 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121955992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 316 (E316G)

Ref Sequence

ENSEMBL: ENSMUSP00000058990 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057576] [ENSMUST00000205438]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057576
AA Change: E316G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058990
Gene: ENSMUSG00000034951
AA Change: E316G

Domain	Start	End	E-Value	Type
Pfam:COG7	2	767	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148634

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205438
AA Change: E316G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the golgi, and constitutes one of the 8 subunits of the conserved oligomeric Golgi (COG) complex, which is required for normal golgi morphology and localization. Mutations in this gene are associated with the congenital disorder of glycosylation type IIe.[provided by RefSeq, May 2010]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Cog7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02023:Cog7	APN	7	121943777	critical splice donor site	probably null
IGL02094:Cog7	APN	7	121963247	missense	probably benign	0.21
IGL02113:Cog7	APN	7	121925480	missense	probably damaging	1.00
IGL02151:Cog7	APN	7	121943808	missense	probably damaging	0.97
IGL02365:Cog7	APN	7	121977736	missense	possibly damaging	0.56
IGL02398:Cog7	APN	7	121964209	missense	probably damaging	1.00
IGL02732:Cog7	APN	7	121923367	missense	probably benign	0.05
IGL02887:Cog7	APN	7	121943844	missense	possibly damaging	0.83
R0143:Cog7	UTSW	7	121951164	missense	probably damaging	1.00
R0446:Cog7	UTSW	7	121937072	missense	probably benign
R0521:Cog7	UTSW	7	121941169	critical splice donor site	probably null
R0526:Cog7	UTSW	7	121963271	splice site	probably null
R0658:Cog7	UTSW	7	121956140	splice site	probably benign
R0782:Cog7	UTSW	7	121943797	missense	possibly damaging	0.86
R1029:Cog7	UTSW	7	121930529	critical splice donor site	probably null
R1521:Cog7	UTSW	7	121930574	missense	possibly damaging	0.57
R1639:Cog7	UTSW	7	121981419	missense	probably damaging	1.00
R2023:Cog7	UTSW	7	121936970	missense	probably damaging	0.99
R3896:Cog7	UTSW	7	121941169	critical splice donor site	probably benign
R4240:Cog7	UTSW	7	121925484	missense	possibly damaging	0.50
R4731:Cog7	UTSW	7	121964244	missense	probably benign	0.00
R4732:Cog7	UTSW	7	121964244	missense	probably benign	0.00
R4733:Cog7	UTSW	7	121964244	missense	probably benign	0.00
R4838:Cog7	UTSW	7	121971381	missense	probably damaging	1.00
R5001:Cog7	UTSW	7	121949886	missense	probably damaging	1.00
R5237:Cog7	UTSW	7	121951221	missense	probably damaging	1.00
R5353:Cog7	UTSW	7	121941247	splice site	probably null
R5609:Cog7	UTSW	7	121925460	missense	probably benign	0.12
R5964:Cog7	UTSW	7	121956029	missense	probably damaging	0.99
R6544:Cog7	UTSW	7	121935743	missense	probably damaging	0.99
R6784:Cog7	UTSW	7	121964293	splice site	probably null
R7110:Cog7	UTSW	7	121935776	missense	probably damaging	0.98
R7212:Cog7	UTSW	7	121977314	missense	probably damaging	0.98
R7304:Cog7	UTSW	7	121937139	missense	probably benign	0.04
R8185:Cog7	UTSW	7	121977746	missense	probably damaging	1.00
R8207:Cog7	UTSW	7	121977292	missense	possibly damaging	0.70
R8838:Cog7	UTSW	7	121949883	missense	probably damaging	0.98
R9116:Cog7	UTSW	7	121971338	missense	probably damaging	0.99
R9582:Cog7	UTSW	7	121936977	missense	probably benign	0.00
R9752:Cog7	UTSW	7	121981416	critical splice donor site	probably null
X0066:Cog7	UTSW	7	121977624	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACAATGAAGCTCTCGGAGAGACAC -3'
(R):5'- CTGCCTTGGAACATCAGGAGACAG -3'

Sequencing Primer
(F):5'- GAGAGACACCGACTCTTTCC -3'
(R):5'- CTGTTTGGAAGGCTTCTTCCTG -3'

Posted On

2014-03-14