Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Tktl2'

159991

Institutional Source

Beutler Lab

Gene Symbol

Tktl2

Ensembl Gene

ENSMUSG00000025519

Gene Name

transketolase-like 2

Synonyms

4933401I19Rik

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.567) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66511756-66518335 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66513038 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 416 (N416S)

Ref Sequence

ENSEMBL: ENSMUSP00000138388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002025] [ENSMUST00000183187]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000002025
AA Change: N416S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000002025
Gene: ENSMUSG00000025519
AA Change: N416S

Domain	Start	End	E-Value	Type
Pfam:DXP_synthase_N	2	195	2.4e-9	PFAM
Pfam:Transketolase_N	16	281	4.6e-50	PFAM
Pfam:TPP_enzyme_C	108	250	5.9e-8	PFAM
Pfam:E1_dh	111	249	2.9e-13	PFAM
Transket_pyr	320	484	3.74e-51	SMART
Pfam:Transketolase_C	495	617	1.4e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000183187
AA Change: N416S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138388
Gene: ENSMUSG00000025519
AA Change: N416S

Domain	Start	End	E-Value	Type
Pfam:DXP_synthase_N	2	197	8.2e-9	PFAM
Pfam:Transketolase_N	16	280	2.2e-86	PFAM
Pfam:TPP_enzyme_C	108	250	5.9e-8	PFAM
Pfam:E1_dh	110	251	2.1e-14	PFAM
Transket_pyr	320	484	3.74e-51	SMART
Pfam:Transketolase_C	495	617	3.4e-30	PFAM

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Tktl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01351:Tktl2	APN	8	66512896	missense	probably benign	0.00
IGL02444:Tktl2	APN	8	66513361	missense	possibly damaging	0.60
IGL02798:Tktl2	APN	8	66513311	missense	probably benign	0.06
IGL02938:Tktl2	APN	8	66512330	missense	probably damaging	1.00
IGL03095:Tktl2	APN	8	66512284	missense	probably damaging	1.00
R0530:Tktl2	UTSW	8	66513179	missense	probably damaging	0.99
R0899:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R0900:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1080:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1609:Tktl2	UTSW	8	66512852	missense	probably benign	0.04
R1717:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1718:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1719:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1848:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1933:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1934:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R2134:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R2135:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R2314:Tktl2	UTSW	8	66513143	missense	probably damaging	1.00
R2509:Tktl2	UTSW	8	66512852	missense	probably benign	0.04
R2511:Tktl2	UTSW	8	66512852	missense	probably benign	0.04
R2965:Tktl2	UTSW	8	66512063	missense	probably benign	0.01
R3084:Tktl2	UTSW	8	66513206	missense	possibly damaging	0.88
R3085:Tktl2	UTSW	8	66513206	missense	possibly damaging	0.88
R3121:Tktl2	UTSW	8	66512156	missense	probably damaging	0.98
R3499:Tktl2	UTSW	8	66513245	missense	probably damaging	0.97
R4227:Tktl2	UTSW	8	66513699	splice site	probably null
R4284:Tktl2	UTSW	8	66513156	missense	probably damaging	1.00
R4491:Tktl2	UTSW	8	66512012	missense	probably damaging	0.96
R5478:Tktl2	UTSW	8	66513398	missense	probably damaging	0.99
R5801:Tktl2	UTSW	8	66513647	missense	probably benign	0.00
R6656:Tktl2	UTSW	8	66512729	missense	probably benign
R6864:Tktl2	UTSW	8	66512339	missense	probably damaging	1.00
R6915:Tktl2	UTSW	8	66513035	missense	probably damaging	1.00
R7168:Tktl2	UTSW	8	66513101	missense	probably damaging	1.00
R7442:Tktl2	UTSW	8	66512909	missense	possibly damaging	0.95
R7617:Tktl2	UTSW	8	66512999	missense	probably benign	0.07
R7687:Tktl2	UTSW	8	66513101	missense	probably damaging	1.00
R8825:Tktl2	UTSW	8	66513667	missense	possibly damaging	0.87
R9155:Tktl2	UTSW	8	66513206	missense	possibly damaging	0.88
R9176:Tktl2	UTSW	8	66512012	missense	probably damaging	0.96
R9352:Tktl2	UTSW	8	66513322	missense	possibly damaging	0.88
R9514:Tktl2	UTSW	8	66513188	missense	probably damaging	0.98
R9633:Tktl2	UTSW	8	66513161	missense	probably benign	0.25
RF006:Tktl2	UTSW	8	66512852	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TTCAAGAAAGAGCACCCTGAGCG -3'
(R):5'- ACCTTGGCCTGTCCAATCACAAAG -3'

Sequencing Primer
(F):5'- ACCCTGAGCGTTTCATAGAG -3'
(R):5'- TGGTACGAATGAAGCACATTCC -3'

Posted On

2014-03-14