Incidental Mutation 'R1419:Tktl2'
ID159991
Institutional Source Beutler Lab
Gene Symbol Tktl2
Ensembl Gene ENSMUSG00000025519
Gene Nametransketolase-like 2
Synonyms4933401I19Rik
MMRRC Submission 039475-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R1419 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location66511756-66518335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66513038 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 416 (N416S)
Ref Sequence ENSEMBL: ENSMUSP00000138388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002025] [ENSMUST00000183187]
Predicted Effect probably damaging
Transcript: ENSMUST00000002025
AA Change: N416S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002025
Gene: ENSMUSG00000025519
AA Change: N416S

DomainStartEndE-ValueType
Pfam:DXP_synthase_N 2 195 2.4e-9 PFAM
Pfam:Transketolase_N 16 281 4.6e-50 PFAM
Pfam:TPP_enzyme_C 108 250 5.9e-8 PFAM
Pfam:E1_dh 111 249 2.9e-13 PFAM
Transket_pyr 320 484 3.74e-51 SMART
Pfam:Transketolase_C 495 617 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183187
AA Change: N416S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138388
Gene: ENSMUSG00000025519
AA Change: N416S

DomainStartEndE-ValueType
Pfam:DXP_synthase_N 2 197 8.2e-9 PFAM
Pfam:Transketolase_N 16 280 2.2e-86 PFAM
Pfam:TPP_enzyme_C 108 250 5.9e-8 PFAM
Pfam:E1_dh 110 251 2.1e-14 PFAM
Transket_pyr 320 484 3.74e-51 SMART
Pfam:Transketolase_C 495 617 3.4e-30 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,374,902 M894K probably benign Het
Ablim1 C A 19: 57,134,633 C173F probably damaging Het
Abtb2 G T 2: 103,709,420 R710L probably benign Het
AI481877 T C 4: 59,064,457 T826A possibly damaging Het
Arap3 T C 18: 37,978,432 T1144A possibly damaging Het
Arhgef12 A T 9: 43,027,220 V92D probably damaging Het
Ash1l T G 3: 88,984,897 M1361R probably damaging Het
Atm A C 9: 53,457,489 N2337K probably benign Het
Cog7 T C 7: 121,955,992 E316G probably damaging Het
Dsp A G 13: 38,186,695 Y858C probably damaging Het
Enc1 G T 13: 97,246,184 G401C probably damaging Het
Gata6 T C 18: 11,064,706 V506A probably benign Het
Gm16380 C T 9: 53,884,187 noncoding transcript Het
H2-Ke6 G A 17: 34,027,643 R89C probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift80 T A 3: 68,940,198 N322Y probably damaging Het
Igsf9 T A 1: 172,498,011 V1082E probably damaging Het
Katnal2 A T 18: 76,977,432 L481Q possibly damaging Het
Kcnma1 T C 14: 23,367,642 T713A probably damaging Het
Kif13a T C 13: 46,825,235 T230A probably damaging Het
Klhl14 C A 18: 21,652,193 R59L probably damaging Het
Mecom A G 3: 29,980,889 C213R probably damaging Het
Mrpl13 T A 15: 55,534,321 M178L probably benign Het
Myof T C 19: 37,901,911 E1971G probably damaging Het
Naa10 A G X: 73,917,916 V133A probably damaging Het
Nlrp4g G A 9: 124,349,434 noncoding transcript Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1042 A G 2: 86,159,429 *314Q probably null Het
Olfr1234 T C 2: 89,363,322 T36A probably damaging Het
Olfr1297 A T 2: 111,621,295 F260I probably benign Het
Oplah T C 15: 76,297,920 I1047V probably benign Het
Paip1 A G 13: 119,457,017 D189G probably damaging Het
Pkn1 A G 8: 83,673,522 F624L probably damaging Het
Plxnb1 C A 9: 109,114,386 P1899H probably damaging Het
Rpa3 T A 6: 8,257,720 E47D probably benign Het
Snai2 C T 16: 14,708,180 H232Y possibly damaging Het
Spint5 T C 2: 164,715,411 S23P possibly damaging Het
St8sia2 G A 7: 73,966,994 Q78* probably null Het
Tm7sf3 T A 6: 146,603,977 I494F possibly damaging Het
Trf C T 9: 103,226,108 V119M probably damaging Het
Other mutations in Tktl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Tktl2 APN 8 66512896 missense probably benign 0.00
IGL02444:Tktl2 APN 8 66513361 missense possibly damaging 0.60
IGL02798:Tktl2 APN 8 66513311 missense probably benign 0.06
IGL02938:Tktl2 APN 8 66512330 missense probably damaging 1.00
IGL03095:Tktl2 APN 8 66512284 missense probably damaging 1.00
R0530:Tktl2 UTSW 8 66513179 missense probably damaging 0.99
R0899:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R0900:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1080:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1609:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R1717:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1718:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1719:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1848:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1933:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1934:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2134:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2135:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2314:Tktl2 UTSW 8 66513143 missense probably damaging 1.00
R2509:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R2511:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R2965:Tktl2 UTSW 8 66512063 missense probably benign 0.01
R3084:Tktl2 UTSW 8 66513206 missense possibly damaging 0.88
R3085:Tktl2 UTSW 8 66513206 missense possibly damaging 0.88
R3121:Tktl2 UTSW 8 66512156 missense probably damaging 0.98
R3499:Tktl2 UTSW 8 66513245 missense probably damaging 0.97
R4227:Tktl2 UTSW 8 66513699 splice site probably null
R4284:Tktl2 UTSW 8 66513156 missense probably damaging 1.00
R4491:Tktl2 UTSW 8 66512012 missense probably damaging 0.96
R5478:Tktl2 UTSW 8 66513398 missense probably damaging 0.99
R5801:Tktl2 UTSW 8 66513647 missense probably benign 0.00
R6656:Tktl2 UTSW 8 66512729 missense probably benign
R6864:Tktl2 UTSW 8 66512339 missense probably damaging 1.00
R6915:Tktl2 UTSW 8 66513035 missense probably damaging 1.00
R7168:Tktl2 UTSW 8 66513101 missense probably damaging 1.00
R7442:Tktl2 UTSW 8 66512909 missense possibly damaging 0.95
R7617:Tktl2 UTSW 8 66512999 missense probably benign 0.07
R7687:Tktl2 UTSW 8 66513101 missense probably damaging 1.00
RF006:Tktl2 UTSW 8 66512852 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTCAAGAAAGAGCACCCTGAGCG -3'
(R):5'- ACCTTGGCCTGTCCAATCACAAAG -3'

Sequencing Primer
(F):5'- ACCCTGAGCGTTTCATAGAG -3'
(R):5'- TGGTACGAATGAAGCACATTCC -3'
Posted On2014-03-14