Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Atm'

159995

Institutional Source

Beutler Lab

Gene Symbol

Atm

Ensembl Gene

ENSMUSG00000034218

Gene Name

ataxia telangiectasia mutated

Synonyms

C030026E19Rik

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53439149-53536740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53457489 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 2337 (N2337K)

Ref Sequence

ENSEMBL: ENSMUSP00000156344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000118282
AA Change: N2334K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: N2334K

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132249

SMART Domains

Protein: ENSMUSP00000118199
Gene: ENSMUSG00000034218

Domain	Start	End	E-Value	Type
PI3Kc	68	201	5.38e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000232179
AA Change: N2337K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Atm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Atm	APN	9	53524443	missense	probably damaging	1.00
IGL00466:Atm	APN	9	53499112	splice site	probably benign
IGL00567:Atm	APN	9	53503116	nonsense	probably null
IGL00702:Atm	APN	9	53511831	missense	probably benign	0.02
IGL00743:Atm	APN	9	53513116	missense	probably benign	0.00
IGL00771:Atm	APN	9	53493054	missense	probably benign	0.01
IGL00773:Atm	APN	9	53522144	missense	probably benign	0.00
IGL00819:Atm	APN	9	53518531	missense	probably damaging	1.00
IGL00864:Atm	APN	9	53533933	missense	probably damaging	0.99
IGL00985:Atm	APN	9	53459816	missense	probably damaging	0.98
IGL01109:Atm	APN	9	53490293	missense	probably damaging	1.00
IGL01120:Atm	APN	9	53461122	critical splice acceptor site	probably null
IGL01369:Atm	APN	9	53515317	missense	probably benign
IGL01374:Atm	APN	9	53531724	missense	possibly damaging	0.58
IGL01406:Atm	APN	9	53439746	makesense	probably null
IGL01409:Atm	APN	9	53499171	missense	probably benign	0.01
IGL01434:Atm	APN	9	53507807	missense	probably benign	0.04
IGL01486:Atm	APN	9	53510213	missense	probably benign
IGL01583:Atm	APN	9	53484247	splice site	probably benign
IGL01861:Atm	APN	9	53494612	missense	probably null	0.89
IGL01865:Atm	APN	9	53461002	missense	probably damaging	1.00
IGL02026:Atm	APN	9	53442417	splice site	probably null
IGL02072:Atm	APN	9	53459796	missense	probably benign	0.01
IGL02075:Atm	APN	9	53527237	missense	probably damaging	1.00
IGL02127:Atm	APN	9	53487983	missense	probably damaging	1.00
IGL02175:Atm	APN	9	53480665	missense	probably damaging	0.99
IGL02246:Atm	APN	9	53527185	missense	probably benign	0.12
IGL02259:Atm	APN	9	53518494	splice site	probably benign
IGL02351:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02358:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02387:Atm	APN	9	53479766	splice site	probably null
IGL02417:Atm	APN	9	53479695	missense	probably benign	0.00
IGL02422:Atm	APN	9	53500792	missense	probably damaging	1.00
IGL02445:Atm	APN	9	53454330	missense	probably benign	0.00
IGL02492:Atm	APN	9	53455859	missense	probably damaging	0.99
IGL02513:Atm	APN	9	53497262	splice site	probably benign
IGL02633:Atm	APN	9	53448153	missense	probably damaging	1.00
IGL02634:Atm	APN	9	53516563	missense	probably benign	0.00
IGL02948:Atm	APN	9	53453440	splice site	probably benign
IGL02959:Atm	APN	9	53471418	missense	probably damaging	1.00
IGL02965:Atm	APN	9	53453563	missense	probably damaging	1.00
IGL03085:Atm	APN	9	53484171	missense	possibly damaging	0.89
antebellum	UTSW	9	53518559	nonsense	probably null
bull_run	UTSW	9	53487922	missense	probably benign	0.09
Civil	UTSW	9	53492268	missense	possibly damaging	0.78
gettysburg	UTSW	9	53455988	splice site	probably null
Grant	UTSW	9	53511917	nonsense	probably null
Indicative	UTSW	9	53445376	splice site	probably null
Marker	UTSW	9	53454279	splice site	probably benign
maunder	UTSW	9	53499197	nonsense	probably null
mockingbird	UTSW	9	53516467	nonsense	probably null
mockingbird2	UTSW	9	53488587	missense	probably damaging	1.00
osphere	UTSW	9	53479673	missense	probably damaging	0.99
shiloh	UTSW	9	53465298	missense	probably damaging	1.00
Strato	UTSW	9	53503018	missense	probably damaging	1.00
thrasher	UTSW	9	53445507	missense	probably benign	0.01
Tropo	UTSW	9	53531648	missense	probably damaging	1.00
P0019:Atm	UTSW	9	53465028	splice site	probably benign
PIT4403001:Atm	UTSW	9	53500982	missense	probably benign
PIT4687001:Atm	UTSW	9	53486812	critical splice donor site	probably null
R0004:Atm	UTSW	9	53453528	splice site	probably benign
R0035:Atm	UTSW	9	53513180	missense	probably benign	0.01
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0201:Atm	UTSW	9	53454279	splice site	probably benign
R0304:Atm	UTSW	9	53516344	missense	probably benign	0.34
R0308:Atm	UTSW	9	53454473	splice site	probably null
R0362:Atm	UTSW	9	53458838	missense	possibly damaging	0.90
R0470:Atm	UTSW	9	53460966	missense	probably damaging	1.00
R0513:Atm	UTSW	9	53503948	missense	probably benign	0.00
R0589:Atm	UTSW	9	53490192	missense	possibly damaging	0.51
R0617:Atm	UTSW	9	53458941	nonsense	probably null
R0630:Atm	UTSW	9	53531622	splice site	probably benign
R0652:Atm	UTSW	9	53486014	missense	probably damaging	0.98
R0698:Atm	UTSW	9	53515239	missense	probably damaging	1.00
R0737:Atm	UTSW	9	53456566	missense	probably damaging	1.00
R0885:Atm	UTSW	9	53459823	missense	probably benign
R0947:Atm	UTSW	9	53504092	missense	probably benign	0.01
R0948:Atm	UTSW	9	53495958	missense	probably benign
R1144:Atm	UTSW	9	53511698	splice site	probably benign
R1252:Atm	UTSW	9	53455840	missense	probably damaging	1.00
R1295:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1296:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1477:Atm	UTSW	9	53464273	missense	probably benign	0.00
R1596:Atm	UTSW	9	53453378	missense	probably damaging	1.00
R1630:Atm	UTSW	9	53479673	missense	probably damaging	0.99
R1667:Atm	UTSW	9	53500932	missense	probably damaging	1.00
R1681:Atm	UTSW	9	53522155	missense	possibly damaging	0.94
R1703:Atm	UTSW	9	53500700	missense	probably benign
R1817:Atm	UTSW	9	53492233	splice site	probably benign
R1840:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1848:Atm	UTSW	9	53468012	missense	probably benign	0.06
R1906:Atm	UTSW	9	53506568	missense	probably damaging	1.00
R1958:Atm	UTSW	9	53471418	missense	probably damaging	1.00
R2108:Atm	UTSW	9	53443997	missense	probably damaging	1.00
R2116:Atm	UTSW	9	53500969	missense	probably benign	0.36
R2134:Atm	UTSW	9	53467964	critical splice donor site	probably null
R2137:Atm	UTSW	9	53453375	missense	probably damaging	1.00
R2291:Atm	UTSW	9	53490909	splice site	probably null
R2348:Atm	UTSW	9	53492268	missense	possibly damaging	0.78
R2483:Atm	UTSW	9	53510266	missense	probably damaging	1.00
R2567:Atm	UTSW	9	53457470	missense	possibly damaging	0.72
R2897:Atm	UTSW	9	53507805	missense	probably damaging	0.99
R2939:Atm	UTSW	9	53494711	missense	probably damaging	1.00
R3008:Atm	UTSW	9	53480750	missense	probably benign	0.00
R3236:Atm	UTSW	9	53479748	missense	probably benign	0.15
R3847:Atm	UTSW	9	53503075	missense	possibly damaging	0.94
R3889:Atm	UTSW	9	53506636	splice site	probably benign
R3919:Atm	UTSW	9	53492278	missense	probably benign	0.00
R4125:Atm	UTSW	9	53450621	missense	probably damaging	1.00
R4222:Atm	UTSW	9	53480669	missense	probably benign
R4395:Atm	UTSW	9	53465227	missense	probably benign	0.09
R4466:Atm	UTSW	9	53448169	nonsense	probably null
R4502:Atm	UTSW	9	53495946	missense	possibly damaging	0.92
R4514:Atm	UTSW	9	53493039	missense	probably damaging	0.99
R4528:Atm	UTSW	9	53500759	missense	probably benign	0.39
R4593:Atm	UTSW	9	53453594	missense	possibly damaging	0.55
R4627:Atm	UTSW	9	53456506	missense	possibly damaging	0.79
R4634:Atm	UTSW	9	53531733	missense	probably benign	0.01
R4665:Atm	UTSW	9	53464229	missense	probably benign	0.00
R4672:Atm	UTSW	9	53522201	missense	probably damaging	0.99
R4741:Atm	UTSW	9	53453607	missense	probably benign	0.10
R4808:Atm	UTSW	9	53445495	missense	probably damaging	0.99
R4959:Atm	UTSW	9	53515301	missense	probably benign
R4996:Atm	UTSW	9	53524507	missense	probably benign	0.09
R5030:Atm	UTSW	9	53520109	nonsense	probably null
R5214:Atm	UTSW	9	53491027	missense	probably benign	0.09
R5260:Atm	UTSW	9	53506611	missense	probably damaging	0.99
R5311:Atm	UTSW	9	53518623	missense	probably benign	0.00
R5394:Atm	UTSW	9	53507777	critical splice donor site	probably null
R5400:Atm	UTSW	9	53503018	missense	probably damaging	1.00
R5436:Atm	UTSW	9	53459804	missense	probably benign	0.00
R5441:Atm	UTSW	9	53516467	nonsense	probably null
R5569:Atm	UTSW	9	53516450	nonsense	probably null
R5856:Atm	UTSW	9	53495955	missense	possibly damaging	0.64
R5891:Atm	UTSW	9	53497159	missense	probably benign
R5910:Atm	UTSW	9	53448080	missense	probably damaging	0.96
R6054:Atm	UTSW	9	53459873	missense	probably damaging	1.00
R6062:Atm	UTSW	9	53488587	missense	probably damaging	1.00
R6092:Atm	UTSW	9	53524414	missense	probably damaging	1.00
R6127:Atm	UTSW	9	53524509	missense	probably damaging	1.00
R6160:Atm	UTSW	9	53490959	missense	probably benign	0.04
R6267:Atm	UTSW	9	53444000	missense	probably damaging	1.00
R6273:Atm	UTSW	9	53487922	missense	probably benign	0.09
R6284:Atm	UTSW	9	53445376	splice site	probably null
R6478:Atm	UTSW	9	53490254	missense	probably damaging	1.00
R6547:Atm	UTSW	9	53440157	missense	probably damaging	1.00
R6549:Atm	UTSW	9	53493177	missense	probably benign	0.00
R6704:Atm	UTSW	9	53458853	missense	probably benign	0.02
R6715:Atm	UTSW	9	53531648	missense	probably damaging	1.00
R6737:Atm	UTSW	9	53486051	missense	probably benign	0.30
R6759:Atm	UTSW	9	53518559	nonsense	probably null
R6766:Atm	UTSW	9	53490282	missense	probably damaging	0.99
R6813:Atm	UTSW	9	53497235	missense	probably benign	0.00
R6852:Atm	UTSW	9	53482430	missense	possibly damaging	0.93
R7064:Atm	UTSW	9	53507881	missense	probably benign	0.02
R7208:Atm	UTSW	9	53512008	splice site	probably null
R7211:Atm	UTSW	9	53488560	missense	probably benign	0.01
R7220:Atm	UTSW	9	53511917	nonsense	probably null
R7336:Atm	UTSW	9	53462503	missense	possibly damaging	0.47
R7363:Atm	UTSW	9	53465298	missense	probably damaging	1.00
R7378:Atm	UTSW	9	53453437	critical splice acceptor site	probably null
R7472:Atm	UTSW	9	53448125	missense	possibly damaging	0.81
R7487:Atm	UTSW	9	53524354	missense	probably benign
R7497:Atm	UTSW	9	53511891	missense	probably benign	0.00
R7584:Atm	UTSW	9	53513127	missense	probably damaging	0.99
R7624:Atm	UTSW	9	53454768	missense	probably damaging	0.99
R7653:Atm	UTSW	9	53490302	nonsense	probably null
R7660:Atm	UTSW	9	53445507	missense	probably benign	0.01
R7679:Atm	UTSW	9	53442497	missense	probably damaging	1.00
R7720:Atm	UTSW	9	53522239	missense	possibly damaging	0.54
R8221:Atm	UTSW	9	53455988	splice site	probably null
R8247:Atm	UTSW	9	53450570	missense
R8334:Atm	UTSW	9	53522273	missense	probably benign	0.00
R8503:Atm	UTSW	9	53488052	missense	probably damaging	0.99
R8552:Atm	UTSW	9	53524497	missense	probably damaging	1.00
R8749:Atm	UTSW	9	53499197	nonsense	probably null
R8838:Atm	UTSW	9	53516551	missense	probably damaging	0.99
R9126:Atm	UTSW	9	53458834	missense	probably benign	0.01
R9131:Atm	UTSW	9	53533744	missense	probably benign	0.10
R9191:Atm	UTSW	9	53527290	missense	probably benign	0.29
R9257:Atm	UTSW	9	53495850	critical splice donor site	probably null
R9473:Atm	UTSW	9	53498972	missense	probably benign
R9558:Atm	UTSW	9	53500781	missense	probably benign	0.00
R9598:Atm	UTSW	9	53520081	missense	probably benign	0.34
R9717:Atm	UTSW	9	53516517	missense	probably damaging	1.00
R9794:Atm	UTSW	9	53518567	missense	probably benign
X0067:Atm	UTSW	9	53479694	missense	probably benign	0.00
Z1088:Atm	UTSW	9	53531687	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAACGGATTACAGAGCCCCAGC -3'
(R):5'- TATCACATCCAGTGGACAGGACACTGC -3'

Sequencing Primer
(F):5'- TGAAACCACACTTGCGTTTG -3'
(R):5'- cctcattttttgcatggacaaatag -3'

Posted On

2014-03-14