Incidental Mutation 'R1419:Trf'
ID159997
Institutional Source Beutler Lab
Gene Symbol Trf
Ensembl Gene ENSMUSG00000032554
Gene Nametransferrin
SynonymsHP, Tfn
MMRRC Submission 039475-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1419 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location103204001-103230444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103226108 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 119 (V119M)
Ref Sequence ENSEMBL: ENSMUSP00000129013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035158] [ENSMUST00000112645] [ENSMUST00000126359] [ENSMUST00000164377] [ENSMUST00000165296] [ENSMUST00000166836] [ENSMUST00000170904]
Predicted Effect probably damaging
Transcript: ENSMUST00000035158
AA Change: V119M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035158
Gene: ENSMUSG00000032554
AA Change: V119M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112503
Predicted Effect probably damaging
Transcript: ENSMUST00000112645
AA Change: V119M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108264
Gene: ENSMUSG00000032554
AA Change: V119M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 352 5.04e-194 SMART
TR_FER 360 686 8.64e-193 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126359
AA Change: V116M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120472
Gene: ENSMUSG00000032554
AA Change: V116M

DomainStartEndE-ValueType
TR_FER 22 237 2.25e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164377
SMART Domains Protein: ENSMUSP00000128647
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Transferrin 25 72 6.6e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165296
AA Change: V119M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129013
Gene: ENSMUSG00000032554
AA Change: V119M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TR_FER 25 171 5.58e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166836
AA Change: V119M

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639
AA Change: V119M

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
TR_FER 25 338 4.98e-175 SMART
TR_FER 346 672 8.64e-193 SMART
Pfam:Arf 758 928 1.5e-15 PFAM
Pfam:SRPRB 769 948 1.4e-73 PFAM
Pfam:MMR_HSR1 773 888 7.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170904
SMART Domains Protein: ENSMUSP00000128390
Gene: ENSMUSG00000032554

DomainStartEndE-ValueType
TR_FER 15 275 7.6e-139 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein with an approximate molecular weight of 76.5 kDa. It is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of this protein is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte/pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit refractory iron-deficient, hypochromic, microcytic anemia with iron-loading in the liver, pancreas, heart and brain. Mutants usually die by two weeks of age. Heterozygotes show minor increases in iron stores. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,374,902 M894K probably benign Het
Ablim1 C A 19: 57,134,633 C173F probably damaging Het
Abtb2 G T 2: 103,709,420 R710L probably benign Het
AI481877 T C 4: 59,064,457 T826A possibly damaging Het
Arap3 T C 18: 37,978,432 T1144A possibly damaging Het
Arhgef12 A T 9: 43,027,220 V92D probably damaging Het
Ash1l T G 3: 88,984,897 M1361R probably damaging Het
Atm A C 9: 53,457,489 N2337K probably benign Het
Cog7 T C 7: 121,955,992 E316G probably damaging Het
Dsp A G 13: 38,186,695 Y858C probably damaging Het
Enc1 G T 13: 97,246,184 G401C probably damaging Het
Gata6 T C 18: 11,064,706 V506A probably benign Het
Gm16380 C T 9: 53,884,187 noncoding transcript Het
H2-Ke6 G A 17: 34,027,643 R89C probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift80 T A 3: 68,940,198 N322Y probably damaging Het
Igsf9 T A 1: 172,498,011 V1082E probably damaging Het
Katnal2 A T 18: 76,977,432 L481Q possibly damaging Het
Kcnma1 T C 14: 23,367,642 T713A probably damaging Het
Kif13a T C 13: 46,825,235 T230A probably damaging Het
Klhl14 C A 18: 21,652,193 R59L probably damaging Het
Mecom A G 3: 29,980,889 C213R probably damaging Het
Mrpl13 T A 15: 55,534,321 M178L probably benign Het
Myof T C 19: 37,901,911 E1971G probably damaging Het
Naa10 A G X: 73,917,916 V133A probably damaging Het
Nlrp4g G A 9: 124,349,434 noncoding transcript Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1042 A G 2: 86,159,429 *314Q probably null Het
Olfr1234 T C 2: 89,363,322 T36A probably damaging Het
Olfr1297 A T 2: 111,621,295 F260I probably benign Het
Oplah T C 15: 76,297,920 I1047V probably benign Het
Paip1 A G 13: 119,457,017 D189G probably damaging Het
Pkn1 A G 8: 83,673,522 F624L probably damaging Het
Plxnb1 C A 9: 109,114,386 P1899H probably damaging Het
Rpa3 T A 6: 8,257,720 E47D probably benign Het
Snai2 C T 16: 14,708,180 H232Y possibly damaging Het
Spint5 T C 2: 164,715,411 S23P possibly damaging Het
St8sia2 G A 7: 73,966,994 Q78* probably null Het
Tktl2 A G 8: 66,513,038 N416S probably damaging Het
Tm7sf3 T A 6: 146,603,977 I494F possibly damaging Het
Other mutations in Trf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Trf APN 9 103220957 missense probably benign 0.00
IGL00424:Trf APN 9 103226936 missense probably damaging 1.00
IGL00793:Trf APN 9 103226143 unclassified probably benign
IGL01139:Trf APN 9 103223604 missense probably damaging 1.00
IGL01658:Trf APN 9 103226856 missense probably benign 0.04
IGL02671:Trf APN 9 103211982 missense probably benign 0.01
IGL02996:Trf APN 9 103220903 missense probably benign 0.01
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0060:Trf UTSW 9 103220922 missense probably benign 0.11
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0096:Trf UTSW 9 103222159 missense probably damaging 1.00
R0112:Trf UTSW 9 103226956 unclassified probably benign
R0234:Trf UTSW 9 103226879 unclassified probably null
R0234:Trf UTSW 9 103226879 unclassified probably null
R0411:Trf UTSW 9 103217501 missense probably damaging 1.00
R0456:Trf UTSW 9 103226903 missense probably damaging 1.00
R0601:Trf UTSW 9 103222933 critical splice donor site probably null
R1606:Trf UTSW 9 103225136 splice site probably null
R3943:Trf UTSW 9 103222952 missense probably benign 0.00
R4431:Trf UTSW 9 103211876 missense possibly damaging 0.81
R4609:Trf UTSW 9 103211985 missense possibly damaging 0.81
R4658:Trf UTSW 9 103223608 missense probably damaging 1.00
R4830:Trf UTSW 9 103227915 missense probably damaging 0.98
R4925:Trf UTSW 9 103219246 missense probably benign 0.00
R4929:Trf UTSW 9 103227875 intron probably benign
R4931:Trf UTSW 9 103228048 missense probably damaging 0.99
R5139:Trf UTSW 9 103222934 critical splice donor site probably null
R5272:Trf UTSW 9 103227978 missense probably damaging 1.00
R5692:Trf UTSW 9 103226125 missense possibly damaging 0.87
R6227:Trf UTSW 9 103230305 start gained probably benign
R6365:Trf UTSW 9 103222128 missense possibly damaging 0.70
R6928:Trf UTSW 9 103222108 missense possibly damaging 0.56
R7127:Trf UTSW 9 103225127 missense probably benign
R7231:Trf UTSW 9 103225148 missense probably damaging 1.00
R7648:Trf UTSW 9 103227969 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCTGACTAACCAGGACTGTGTG -3'
(R):5'- AGCCTTTGTTTTCCCGGATGGACC -3'

Sequencing Primer
(F):5'- TGGCCCCAGCAGTACAG -3'
(R):5'- GATGGACCATCTGTCTTTAAGTCTAC -3'
Posted On2014-03-14