Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Trf'

159997

Institutional Source

Beutler Lab

Gene Symbol

Trf

Ensembl Gene

ENSMUSG00000032554

Gene Name

transferrin

Synonyms

HP, Tfn

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103204001-103230444 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 103226108 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 119 (V119M)

Ref Sequence

ENSEMBL: ENSMUSP00000129013 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035158] [ENSMUST00000112645] [ENSMUST00000126359] [ENSMUST00000164377] [ENSMUST00000165296] [ENSMUST00000166836] [ENSMUST00000170904]

AlphaFold

Q921I1

Predicted Effect

probably damaging
Transcript: ENSMUST00000035158
AA Change: V119M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035158
Gene: ENSMUSG00000032554
AA Change: V119M

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
TR_FER	25	352	5.04e-194	SMART
TR_FER	360	686	8.64e-193	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112503

Predicted Effect

probably damaging
Transcript: ENSMUST00000112645
AA Change: V119M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108264
Gene: ENSMUSG00000032554
AA Change: V119M

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
TR_FER	25	352	5.04e-194	SMART
TR_FER	360	686	8.64e-193	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000126359
AA Change: V116M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000120472
Gene: ENSMUSG00000032554
AA Change: V116M

Domain	Start	End	E-Value	Type
TR_FER	22	237	2.25e-77	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164377

SMART Domains

Protein: ENSMUSP00000128647
Gene: ENSMUSG00000032554

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Transferrin	25	72	6.6e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165296
AA Change: V119M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129013
Gene: ENSMUSG00000032554
AA Change: V119M

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
TR_FER	25	171	5.58e-15	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166836
AA Change: V119M

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639
AA Change: V119M

Domain	Start	End	E-Value	Type
low complexity region	6	19	N/A	INTRINSIC
TR_FER	25	338	4.98e-175	SMART
TR_FER	346	672	8.64e-193	SMART
Pfam:Arf	758	928	1.5e-15	PFAM
Pfam:SRPRB	769	948	1.4e-73	PFAM
Pfam:MMR_HSR1	773	888	7.8e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170904

SMART Domains

Protein: ENSMUSP00000128390
Gene: ENSMUSG00000032554

Domain	Start	End	E-Value	Type
TR_FER	15	275	7.6e-139	SMART

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein with an approximate molecular weight of 76.5 kDa. It is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of this protein is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte/pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit refractory iron-deficient, hypochromic, microcytic anemia with iron-loading in the liver, pancreas, heart and brain. Mutants usually die by two weeks of age. Heterozygotes show minor increases in iron stores. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het

Other mutations in Trf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Trf	APN	9	103220957	missense	probably benign	0.00
IGL00424:Trf	APN	9	103226936	missense	probably damaging	1.00
IGL00793:Trf	APN	9	103226143	unclassified	probably benign
IGL01139:Trf	APN	9	103223604	missense	probably damaging	1.00
IGL01658:Trf	APN	9	103226856	missense	probably benign	0.04
IGL02671:Trf	APN	9	103211982	missense	probably benign	0.01
IGL02996:Trf	APN	9	103220903	missense	probably benign	0.01
R0060:Trf	UTSW	9	103220922	missense	probably benign	0.11
R0060:Trf	UTSW	9	103220922	missense	probably benign	0.11
R0096:Trf	UTSW	9	103222159	missense	probably damaging	1.00
R0096:Trf	UTSW	9	103222159	missense	probably damaging	1.00
R0112:Trf	UTSW	9	103226956	unclassified	probably benign
R0234:Trf	UTSW	9	103226879	splice site	probably null
R0234:Trf	UTSW	9	103226879	splice site	probably null
R0411:Trf	UTSW	9	103217501	missense	probably damaging	1.00
R0456:Trf	UTSW	9	103226903	missense	probably damaging	1.00
R0601:Trf	UTSW	9	103222933	critical splice donor site	probably null
R1606:Trf	UTSW	9	103225136	splice site	probably null
R3943:Trf	UTSW	9	103222952	missense	probably benign	0.00
R4431:Trf	UTSW	9	103211876	missense	possibly damaging	0.81
R4609:Trf	UTSW	9	103211985	missense	possibly damaging	0.81
R4658:Trf	UTSW	9	103223608	missense	probably damaging	1.00
R4830:Trf	UTSW	9	103227915	missense	probably damaging	0.98
R4925:Trf	UTSW	9	103219246	missense	probably benign	0.00
R4929:Trf	UTSW	9	103227875	intron	probably benign
R4931:Trf	UTSW	9	103228048	missense	probably damaging	0.99
R5139:Trf	UTSW	9	103222934	critical splice donor site	probably null
R5272:Trf	UTSW	9	103227978	missense	probably damaging	1.00
R5692:Trf	UTSW	9	103226125	missense	possibly damaging	0.87
R6227:Trf	UTSW	9	103230305	start gained	probably benign
R6365:Trf	UTSW	9	103222128	missense	possibly damaging	0.70
R6928:Trf	UTSW	9	103222108	missense	possibly damaging	0.56
R7127:Trf	UTSW	9	103225127	missense	probably benign
R7231:Trf	UTSW	9	103225148	missense	probably damaging	1.00
R7648:Trf	UTSW	9	103227969	missense	probably benign	0.01
R8088:Trf	UTSW	9	103211931	missense	probably damaging	1.00
R8095:Trf	UTSW	9	103210536	missense	probably damaging	1.00
R8317:Trf	UTSW	9	103217516	missense	probably damaging	1.00
R8443:Trf	UTSW	9	103217476	missense	probably damaging	0.98
R8735:Trf	UTSW	9	103210524	missense	probably damaging	0.99
R8854:Trf	UTSW	9	103230330	unclassified	probably benign
R9131:Trf	UTSW	9	103211888	missense	probably damaging	0.99
R9360:Trf	UTSW	9	103217535	critical splice acceptor site	probably null
R9499:Trf	UTSW	9	103222084	missense	probably benign	0.00
R9526:Trf	UTSW	9	103226931	missense	probably damaging	1.00
R9551:Trf	UTSW	9	103222084	missense	probably benign	0.00
R9552:Trf	UTSW	9	103222084	missense	probably benign	0.00
R9710:Trf	UTSW	9	103226018	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCTGACTAACCAGGACTGTGTG -3'
(R):5'- AGCCTTTGTTTTCCCGGATGGACC -3'

Sequencing Primer
(F):5'- TGGCCCCAGCAGTACAG -3'
(R):5'- GATGGACCATCTGTCTTTAAGTCTAC -3'

Posted On

2014-03-14