Incidental Mutation 'R1419:Kif13a'
ID 160002
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Name kinesin family member 13A
Synonyms 4930505I07Rik, N-3 kinesin
MMRRC Submission 039475-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.268) question?
Stock # R1419 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 46902563-47083343 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46978711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 230 (T230A)
Ref Sequence ENSEMBL: ENSMUSP00000055304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000056978
AA Change: T230A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: T230A

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225591
AA Change: T167A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,974,125 (GRCm39) M894K probably benign Het
Ablim1 C A 19: 57,123,065 (GRCm39) C173F probably damaging Het
Abtb2 G T 2: 103,539,765 (GRCm39) R710L probably benign Het
Arap3 T C 18: 38,111,485 (GRCm39) T1144A possibly damaging Het
Arhgef12 A T 9: 42,938,516 (GRCm39) V92D probably damaging Het
Ash1l T G 3: 88,892,204 (GRCm39) M1361R probably damaging Het
Atm A C 9: 53,368,789 (GRCm39) N2337K probably benign Het
Cog7 T C 7: 121,555,215 (GRCm39) E316G probably damaging Het
Dsp A G 13: 38,370,671 (GRCm39) Y858C probably damaging Het
Enc1 G T 13: 97,382,692 (GRCm39) G401C probably damaging Het
Gata6 T C 18: 11,064,706 (GRCm39) V506A probably benign Het
Gm16380 C T 9: 53,791,471 (GRCm39) noncoding transcript Het
Hsd17b8 G A 17: 34,246,617 (GRCm39) R89C probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ift80 T A 3: 68,847,531 (GRCm39) N322Y probably damaging Het
Igsf9 T A 1: 172,325,578 (GRCm39) V1082E probably damaging Het
Katnal2 A T 18: 77,065,128 (GRCm39) L481Q possibly damaging Het
Kcnma1 T C 14: 23,417,710 (GRCm39) T713A probably damaging Het
Klhl14 C A 18: 21,785,250 (GRCm39) R59L probably damaging Het
Mecom A G 3: 30,035,038 (GRCm39) C213R probably damaging Het
Mrpl13 T A 15: 55,397,717 (GRCm39) M178L probably benign Het
Myof T C 19: 37,890,359 (GRCm39) E1971G probably damaging Het
Naa10 A G X: 72,961,522 (GRCm39) V133A probably damaging Het
Nlrp4g G A 9: 124,349,434 (GRCm38) noncoding transcript Het
Ofcc1 C T 13: 40,362,305 (GRCm39) G206R probably benign Het
Oplah T C 15: 76,182,120 (GRCm39) I1047V probably benign Het
Or4a15 T C 2: 89,193,666 (GRCm39) T36A probably damaging Het
Or4k47 A T 2: 111,451,640 (GRCm39) F260I probably benign Het
Or5al1 A G 2: 85,989,773 (GRCm39) *314Q probably null Het
Paip1 A G 13: 119,593,553 (GRCm39) D189G probably damaging Het
Pkn1 A G 8: 84,400,151 (GRCm39) F624L probably damaging Het
Plxnb1 C A 9: 108,943,454 (GRCm39) P1899H probably damaging Het
Rpa3 T A 6: 8,257,720 (GRCm39) E47D probably benign Het
Shoc1 T C 4: 59,064,457 (GRCm39) T826A possibly damaging Het
Snai2 C T 16: 14,526,044 (GRCm39) H232Y possibly damaging Het
Spint5 T C 2: 164,557,331 (GRCm39) S23P possibly damaging Het
St8sia2 G A 7: 73,616,742 (GRCm39) Q78* probably null Het
Tktl2 A G 8: 66,965,690 (GRCm39) N416S probably damaging Het
Tm7sf3 T A 6: 146,505,475 (GRCm39) I494F possibly damaging Het
Trf C T 9: 103,103,307 (GRCm39) V119M probably damaging Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46,904,110 (GRCm39) splice site probably benign
IGL01433:Kif13a APN 13 46,926,384 (GRCm39) missense probably damaging 1.00
IGL01528:Kif13a APN 13 47,018,313 (GRCm39) splice site probably benign
IGL01536:Kif13a APN 13 46,905,765 (GRCm39) missense probably damaging 0.96
IGL01620:Kif13a APN 13 47,018,296 (GRCm39) missense probably benign
IGL02020:Kif13a APN 13 46,947,495 (GRCm39) missense probably benign 0.05
IGL02142:Kif13a APN 13 46,925,011 (GRCm39) missense probably benign 0.04
IGL02375:Kif13a APN 13 46,978,698 (GRCm39) missense probably damaging 1.00
IGL02407:Kif13a APN 13 46,938,769 (GRCm39) missense probably damaging 0.99
IGL02476:Kif13a APN 13 46,938,772 (GRCm39) missense probably damaging 1.00
IGL03038:Kif13a APN 13 46,926,314 (GRCm39) missense probably damaging 1.00
IGL03053:Kif13a APN 13 46,905,564 (GRCm39) missense probably benign 0.01
IGL03366:Kif13a APN 13 46,918,099 (GRCm39) missense probably benign 0.00
R0025:Kif13a UTSW 13 46,939,987 (GRCm39) critical splice donor site probably null
R0106:Kif13a UTSW 13 46,978,823 (GRCm39) splice site probably benign
R0106:Kif13a UTSW 13 46,978,823 (GRCm39) splice site probably benign
R0135:Kif13a UTSW 13 46,947,419 (GRCm39) missense probably damaging 0.99
R0137:Kif13a UTSW 13 46,918,079 (GRCm39) missense probably benign 0.38
R0243:Kif13a UTSW 13 46,944,827 (GRCm39) missense probably benign 0.24
R0346:Kif13a UTSW 13 46,967,695 (GRCm39) missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46,944,877 (GRCm39) missense probably damaging 1.00
R0492:Kif13a UTSW 13 46,966,218 (GRCm39) missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46,956,187 (GRCm39) missense probably damaging 0.96
R0631:Kif13a UTSW 13 46,932,364 (GRCm39) unclassified probably benign
R0654:Kif13a UTSW 13 46,966,218 (GRCm39) missense possibly damaging 0.93
R0697:Kif13a UTSW 13 47,001,813 (GRCm39) missense probably benign 0.19
R0699:Kif13a UTSW 13 46,952,689 (GRCm39) missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46,966,299 (GRCm39) missense probably damaging 0.98
R0834:Kif13a UTSW 13 46,967,712 (GRCm39) missense probably damaging 0.96
R0903:Kif13a UTSW 13 47,082,735 (GRCm39) missense possibly damaging 0.75
R1428:Kif13a UTSW 13 46,944,987 (GRCm39) splice site probably benign
R1449:Kif13a UTSW 13 46,966,212 (GRCm39) missense probably damaging 1.00
R1463:Kif13a UTSW 13 47,083,088 (GRCm39) missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46,962,689 (GRCm39) missense probably benign
R1579:Kif13a UTSW 13 46,906,332 (GRCm39) missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46,947,398 (GRCm39) missense probably benign 0.03
R1644:Kif13a UTSW 13 46,947,398 (GRCm39) missense probably benign 0.31
R1752:Kif13a UTSW 13 46,951,885 (GRCm39) missense probably damaging 1.00
R1755:Kif13a UTSW 13 46,927,154 (GRCm39) missense possibly damaging 0.50
R1755:Kif13a UTSW 13 46,906,089 (GRCm39) missense possibly damaging 0.73
R1858:Kif13a UTSW 13 47,018,314 (GRCm39) splice site probably benign
R1891:Kif13a UTSW 13 47,082,695 (GRCm39) missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46,941,638 (GRCm39) missense probably benign 0.00
R1928:Kif13a UTSW 13 46,966,221 (GRCm39) missense probably damaging 1.00
R1960:Kif13a UTSW 13 47,018,314 (GRCm39) splice site probably benign
R1961:Kif13a UTSW 13 47,018,314 (GRCm39) splice site probably benign
R2016:Kif13a UTSW 13 46,964,275 (GRCm39) missense probably benign 0.13
R2139:Kif13a UTSW 13 46,905,945 (GRCm39) missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46,922,652 (GRCm39) missense probably damaging 0.99
R2407:Kif13a UTSW 13 46,930,573 (GRCm39) missense probably damaging 1.00
R2504:Kif13a UTSW 13 46,967,676 (GRCm39) missense probably damaging 1.00
R3122:Kif13a UTSW 13 46,918,072 (GRCm39) splice site probably benign
R3499:Kif13a UTSW 13 46,978,815 (GRCm39) missense probably damaging 1.00
R3905:Kif13a UTSW 13 46,956,166 (GRCm39) missense probably damaging 1.00
R4474:Kif13a UTSW 13 46,967,631 (GRCm39) splice site probably null
R4771:Kif13a UTSW 13 46,978,687 (GRCm39) missense probably damaging 1.00
R4838:Kif13a UTSW 13 46,980,224 (GRCm39) missense probably damaging 1.00
R4924:Kif13a UTSW 13 47,083,075 (GRCm39) missense probably damaging 1.00
R4931:Kif13a UTSW 13 46,962,531 (GRCm39) missense probably damaging 0.96
R4980:Kif13a UTSW 13 46,906,222 (GRCm39) missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46,930,639 (GRCm39) missense probably damaging 0.96
R5047:Kif13a UTSW 13 46,941,561 (GRCm39) missense probably benign 0.00
R5054:Kif13a UTSW 13 46,956,122 (GRCm39) missense probably damaging 1.00
R5141:Kif13a UTSW 13 46,906,197 (GRCm39) missense probably benign
R5329:Kif13a UTSW 13 46,928,877 (GRCm39) critical splice donor site probably null
R5429:Kif13a UTSW 13 46,926,245 (GRCm39) critical splice donor site probably null
R5499:Kif13a UTSW 13 46,986,212 (GRCm39) missense probably damaging 1.00
R5509:Kif13a UTSW 13 46,905,591 (GRCm39) missense probably benign 0.13
R5594:Kif13a UTSW 13 46,906,338 (GRCm39) missense probably damaging 1.00
R5921:Kif13a UTSW 13 46,978,776 (GRCm39) missense probably damaging 1.00
R5964:Kif13a UTSW 13 46,925,000 (GRCm39) missense probably damaging 1.00
R6115:Kif13a UTSW 13 46,954,789 (GRCm39) missense probably damaging 1.00
R6317:Kif13a UTSW 13 46,980,233 (GRCm39) missense probably damaging 1.00
R6318:Kif13a UTSW 13 46,968,683 (GRCm39) splice site probably null
R6393:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46,906,222 (GRCm39) missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46,962,632 (GRCm39) critical splice donor site probably null
R7285:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46,905,931 (GRCm39) missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46,980,221 (GRCm39) missense probably damaging 1.00
R7693:Kif13a UTSW 13 46,904,089 (GRCm39) missense probably benign 0.01
R7761:Kif13a UTSW 13 46,951,955 (GRCm39) missense probably benign
R8098:Kif13a UTSW 13 46,968,780 (GRCm39) missense probably damaging 1.00
R8171:Kif13a UTSW 13 46,932,444 (GRCm39) missense probably damaging 1.00
R8271:Kif13a UTSW 13 46,906,057 (GRCm39) missense probably benign 0.01
R8806:Kif13a UTSW 13 46,914,813 (GRCm39) missense possibly damaging 0.49
R8871:Kif13a UTSW 13 46,984,279 (GRCm39) missense probably damaging 1.00
R8877:Kif13a UTSW 13 46,954,921 (GRCm39) critical splice acceptor site probably null
R8906:Kif13a UTSW 13 46,927,154 (GRCm39) missense probably benign 0.17
R9028:Kif13a UTSW 13 46,951,841 (GRCm39) missense probably damaging 1.00
R9058:Kif13a UTSW 13 46,944,941 (GRCm39) missense probably damaging 1.00
R9062:Kif13a UTSW 13 46,941,536 (GRCm39) missense possibly damaging 0.91
R9070:Kif13a UTSW 13 46,905,934 (GRCm39) missense probably benign 0.00
R9083:Kif13a UTSW 13 46,966,263 (GRCm39) missense probably damaging 1.00
R9250:Kif13a UTSW 13 46,928,909 (GRCm39) missense probably damaging 1.00
R9328:Kif13a UTSW 13 46,951,838 (GRCm39) missense probably damaging 1.00
R9360:Kif13a UTSW 13 46,962,472 (GRCm39) missense probably benign 0.01
R9369:Kif13a UTSW 13 46,940,099 (GRCm39) missense probably damaging 0.99
R9589:Kif13a UTSW 13 46,956,020 (GRCm39) missense probably benign 0.01
R9749:Kif13a UTSW 13 46,914,227 (GRCm39) missense probably damaging 0.96
X0013:Kif13a UTSW 13 47,082,746 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CTCACGGTAGCCATGAAGTAGATTTGG -3'
(R):5'- ATGACTATCCCACAGGGCAAGGAG -3'

Sequencing Primer
(F):5'- gccttgaactcctaatcttcctg -3'
(R):5'- GATCATAGTGGACACATTCTTGG -3'
Posted On 2014-03-14