Incidental Mutation 'R1419:Enc1'
ID160003
Institutional Source Beutler Lab
Gene Symbol Enc1
Ensembl Gene ENSMUSG00000041773
Gene Nameectodermal-neural cortex 1
SynonymsNrpb, PIG10
MMRRC Submission 039475-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1419 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location97241105-97253034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97246184 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 401 (G401C)
Ref Sequence ENSEMBL: ENSMUSP00000038783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041623]
Predicted Effect probably damaging
Transcript: ENSMUST00000041623
AA Change: G401C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038783
Gene: ENSMUSG00000041773
AA Change: G401C

DomainStartEndE-ValueType
BTB 46 144 8.4e-32 SMART
BACK 149 251 7.5e-33 SMART
Kelch 296 340 3.89e0 SMART
Kelch 341 388 2.69e-9 SMART
Kelch 389 444 7.77e-15 SMART
Kelch 445 492 1.97e0 SMART
Kelch 493 538 2.9e-1 SMART
Kelch 539 585 1.5e-7 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-related family of actin-binding proteins. The encoded protein plays a role in the oxidative stress response as a regulator of the transcription factor Nrf2, and expression of this gene may play a role in malignant transformation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,374,902 M894K probably benign Het
Ablim1 C A 19: 57,134,633 C173F probably damaging Het
Abtb2 G T 2: 103,709,420 R710L probably benign Het
AI481877 T C 4: 59,064,457 T826A possibly damaging Het
Arap3 T C 18: 37,978,432 T1144A possibly damaging Het
Arhgef12 A T 9: 43,027,220 V92D probably damaging Het
Ash1l T G 3: 88,984,897 M1361R probably damaging Het
Atm A C 9: 53,457,489 N2337K probably benign Het
Cog7 T C 7: 121,955,992 E316G probably damaging Het
Dsp A G 13: 38,186,695 Y858C probably damaging Het
Gata6 T C 18: 11,064,706 V506A probably benign Het
Gm16380 C T 9: 53,884,187 noncoding transcript Het
H2-Ke6 G A 17: 34,027,643 R89C probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift80 T A 3: 68,940,198 N322Y probably damaging Het
Igsf9 T A 1: 172,498,011 V1082E probably damaging Het
Katnal2 A T 18: 76,977,432 L481Q possibly damaging Het
Kcnma1 T C 14: 23,367,642 T713A probably damaging Het
Kif13a T C 13: 46,825,235 T230A probably damaging Het
Klhl14 C A 18: 21,652,193 R59L probably damaging Het
Mecom A G 3: 29,980,889 C213R probably damaging Het
Mrpl13 T A 15: 55,534,321 M178L probably benign Het
Myof T C 19: 37,901,911 E1971G probably damaging Het
Naa10 A G X: 73,917,916 V133A probably damaging Het
Nlrp4g G A 9: 124,349,434 noncoding transcript Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1042 A G 2: 86,159,429 *314Q probably null Het
Olfr1234 T C 2: 89,363,322 T36A probably damaging Het
Olfr1297 A T 2: 111,621,295 F260I probably benign Het
Oplah T C 15: 76,297,920 I1047V probably benign Het
Paip1 A G 13: 119,457,017 D189G probably damaging Het
Pkn1 A G 8: 83,673,522 F624L probably damaging Het
Plxnb1 C A 9: 109,114,386 P1899H probably damaging Het
Rpa3 T A 6: 8,257,720 E47D probably benign Het
Snai2 C T 16: 14,708,180 H232Y possibly damaging Het
Spint5 T C 2: 164,715,411 S23P possibly damaging Het
St8sia2 G A 7: 73,966,994 Q78* probably null Het
Tktl2 A G 8: 66,513,038 N416S probably damaging Het
Tm7sf3 T A 6: 146,603,977 I494F possibly damaging Het
Trf C T 9: 103,226,108 V119M probably damaging Het
Other mutations in Enc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Enc1 APN 13 97245314 missense probably benign 0.00
IGL02010:Enc1 APN 13 97245080 missense possibly damaging 0.84
IGL02642:Enc1 APN 13 97245534 missense possibly damaging 0.84
IGL03342:Enc1 APN 13 97246470 missense possibly damaging 0.64
R1305:Enc1 UTSW 13 97246700 missense possibly damaging 0.58
R1733:Enc1 UTSW 13 97245042 missense possibly damaging 0.63
R1796:Enc1 UTSW 13 97246483 missense probably benign 0.00
R1796:Enc1 UTSW 13 97246485 missense possibly damaging 0.58
R1823:Enc1 UTSW 13 97245978 missense possibly damaging 0.64
R4107:Enc1 UTSW 13 97245138 missense probably damaging 1.00
R4324:Enc1 UTSW 13 97245897 missense probably benign 0.21
R4922:Enc1 UTSW 13 97245735 missense probably benign 0.08
R5942:Enc1 UTSW 13 97246379 missense probably benign 0.28
R5951:Enc1 UTSW 13 97245257 missense probably benign 0.02
R6229:Enc1 UTSW 13 97245491 missense probably benign
R6985:Enc1 UTSW 13 97245120 missense possibly damaging 0.92
R6987:Enc1 UTSW 13 97245636 missense probably benign 0.14
R7307:Enc1 UTSW 13 97245093 missense probably damaging 1.00
R7442:Enc1 UTSW 13 97246740 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATCATTCCCAAGGCTGACATTCCC -3'
(R):5'- GCACTGACCATCTGTTCTCGCATTG -3'

Sequencing Primer
(F):5'- CATGTGCAATTGGCTGCAAAG -3'
(R):5'- TCGTAACACTGAACCTTGGGC -3'
Posted On2014-03-14