Incidental Mutation 'R1419:Enc1'
ID 160003
Institutional Source Beutler Lab
Gene Symbol Enc1
Ensembl Gene ENSMUSG00000041773
Gene Name ectodermal-neural cortex 1
Synonyms PIG10, Nrpb
MMRRC Submission 039475-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1419 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 97377613-97389542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 97382692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 401 (G401C)
Ref Sequence ENSEMBL: ENSMUSP00000038783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041623]
AlphaFold O35709
Predicted Effect probably damaging
Transcript: ENSMUST00000041623
AA Change: G401C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038783
Gene: ENSMUSG00000041773
AA Change: G401C

DomainStartEndE-ValueType
BTB 46 144 8.4e-32 SMART
BACK 149 251 7.5e-33 SMART
Kelch 296 340 3.89e0 SMART
Kelch 341 388 2.69e-9 SMART
Kelch 389 444 7.77e-15 SMART
Kelch 445 492 1.97e0 SMART
Kelch 493 538 2.9e-1 SMART
Kelch 539 585 1.5e-7 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-related family of actin-binding proteins. The encoded protein plays a role in the oxidative stress response as a regulator of the transcription factor Nrf2, and expression of this gene may play a role in malignant transformation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,974,125 (GRCm39) M894K probably benign Het
Ablim1 C A 19: 57,123,065 (GRCm39) C173F probably damaging Het
Abtb2 G T 2: 103,539,765 (GRCm39) R710L probably benign Het
Arap3 T C 18: 38,111,485 (GRCm39) T1144A possibly damaging Het
Arhgef12 A T 9: 42,938,516 (GRCm39) V92D probably damaging Het
Ash1l T G 3: 88,892,204 (GRCm39) M1361R probably damaging Het
Atm A C 9: 53,368,789 (GRCm39) N2337K probably benign Het
Cog7 T C 7: 121,555,215 (GRCm39) E316G probably damaging Het
Dsp A G 13: 38,370,671 (GRCm39) Y858C probably damaging Het
Gata6 T C 18: 11,064,706 (GRCm39) V506A probably benign Het
Gm16380 C T 9: 53,791,471 (GRCm39) noncoding transcript Het
Hsd17b8 G A 17: 34,246,617 (GRCm39) R89C probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ift80 T A 3: 68,847,531 (GRCm39) N322Y probably damaging Het
Igsf9 T A 1: 172,325,578 (GRCm39) V1082E probably damaging Het
Katnal2 A T 18: 77,065,128 (GRCm39) L481Q possibly damaging Het
Kcnma1 T C 14: 23,417,710 (GRCm39) T713A probably damaging Het
Kif13a T C 13: 46,978,711 (GRCm39) T230A probably damaging Het
Klhl14 C A 18: 21,785,250 (GRCm39) R59L probably damaging Het
Mecom A G 3: 30,035,038 (GRCm39) C213R probably damaging Het
Mrpl13 T A 15: 55,397,717 (GRCm39) M178L probably benign Het
Myof T C 19: 37,890,359 (GRCm39) E1971G probably damaging Het
Naa10 A G X: 72,961,522 (GRCm39) V133A probably damaging Het
Nlrp4g G A 9: 124,349,434 (GRCm38) noncoding transcript Het
Ofcc1 C T 13: 40,362,305 (GRCm39) G206R probably benign Het
Oplah T C 15: 76,182,120 (GRCm39) I1047V probably benign Het
Or4a15 T C 2: 89,193,666 (GRCm39) T36A probably damaging Het
Or4k47 A T 2: 111,451,640 (GRCm39) F260I probably benign Het
Or5al1 A G 2: 85,989,773 (GRCm39) *314Q probably null Het
Paip1 A G 13: 119,593,553 (GRCm39) D189G probably damaging Het
Pkn1 A G 8: 84,400,151 (GRCm39) F624L probably damaging Het
Plxnb1 C A 9: 108,943,454 (GRCm39) P1899H probably damaging Het
Rpa3 T A 6: 8,257,720 (GRCm39) E47D probably benign Het
Shoc1 T C 4: 59,064,457 (GRCm39) T826A possibly damaging Het
Snai2 C T 16: 14,526,044 (GRCm39) H232Y possibly damaging Het
Spint5 T C 2: 164,557,331 (GRCm39) S23P possibly damaging Het
St8sia2 G A 7: 73,616,742 (GRCm39) Q78* probably null Het
Tktl2 A G 8: 66,965,690 (GRCm39) N416S probably damaging Het
Tm7sf3 T A 6: 146,505,475 (GRCm39) I494F possibly damaging Het
Trf C T 9: 103,103,307 (GRCm39) V119M probably damaging Het
Other mutations in Enc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Enc1 APN 13 97,381,822 (GRCm39) missense probably benign 0.00
IGL02010:Enc1 APN 13 97,381,588 (GRCm39) missense possibly damaging 0.84
IGL02642:Enc1 APN 13 97,382,042 (GRCm39) missense possibly damaging 0.84
IGL03342:Enc1 APN 13 97,382,978 (GRCm39) missense possibly damaging 0.64
R1305:Enc1 UTSW 13 97,383,208 (GRCm39) missense possibly damaging 0.58
R1733:Enc1 UTSW 13 97,381,550 (GRCm39) missense possibly damaging 0.63
R1796:Enc1 UTSW 13 97,382,993 (GRCm39) missense possibly damaging 0.58
R1796:Enc1 UTSW 13 97,382,991 (GRCm39) missense probably benign 0.00
R1823:Enc1 UTSW 13 97,382,486 (GRCm39) missense possibly damaging 0.64
R4107:Enc1 UTSW 13 97,381,646 (GRCm39) missense probably damaging 1.00
R4324:Enc1 UTSW 13 97,382,405 (GRCm39) missense probably benign 0.21
R4922:Enc1 UTSW 13 97,382,243 (GRCm39) missense probably benign 0.08
R5942:Enc1 UTSW 13 97,382,887 (GRCm39) missense probably benign 0.28
R5951:Enc1 UTSW 13 97,381,765 (GRCm39) missense probably benign 0.02
R6229:Enc1 UTSW 13 97,381,999 (GRCm39) missense probably benign
R6985:Enc1 UTSW 13 97,381,628 (GRCm39) missense possibly damaging 0.92
R6987:Enc1 UTSW 13 97,382,144 (GRCm39) missense probably benign 0.14
R7307:Enc1 UTSW 13 97,381,601 (GRCm39) missense probably damaging 1.00
R7442:Enc1 UTSW 13 97,383,248 (GRCm39) missense probably benign 0.02
R9329:Enc1 UTSW 13 97,383,018 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATCATTCCCAAGGCTGACATTCCC -3'
(R):5'- GCACTGACCATCTGTTCTCGCATTG -3'

Sequencing Primer
(F):5'- CATGTGCAATTGGCTGCAAAG -3'
(R):5'- TCGTAACACTGAACCTTGGGC -3'
Posted On 2014-03-14