Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Paip1'

160004

Institutional Source

Beutler Lab

Gene Symbol

Paip1

Ensembl Gene

ENSMUSG00000025451

Gene Name

polyadenylate binding protein-interacting protein 1

Synonyms

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119428601-119458218 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119457017 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 189 (D189G)

Ref Sequence

ENSEMBL: ENSMUSP00000134365 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026520] [ENSMUST00000109203] [ENSMUST00000126957] [ENSMUST00000173627] [ENSMUST00000174533]

AlphaFold

Q8VE62

Predicted Effect

probably benign
Transcript: ENSMUST00000026520
AA Change: D380G

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000026520
Gene: ENSMUSG00000025451
AA Change: D380G

Domain	Start	End	E-Value	Type
Pfam:PAM2	44	61	8.9e-8	PFAM
MIF4G	80	297	2.62e-46	SMART
low complexity region	373	385	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109203
AA Change: D347G

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000104826
Gene: ENSMUSG00000025451
AA Change: D347G

Domain	Start	End	E-Value	Type
Pfam:PAM2	11	28	3.7e-7	PFAM
MIF4G	47	264	2.62e-46	SMART
low complexity region	340	352	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000126957
AA Change: D464G

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117256
Gene: ENSMUSG00000025451
AA Change: D464G

Domain	Start	End	E-Value	Type
low complexity region	7	38	N/A	INTRINSIC
low complexity region	44	74	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
Pfam:PAM2	128	145	3.3e-7	PFAM
MIF4G	164	381	2.62e-46	SMART
low complexity region	457	469	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132304

SMART Domains

Protein: ENSMUSP00000134617
Gene: ENSMUSG00000025451

Domain	Start	End	E-Value	Type
low complexity region	7	38	N/A	INTRINSIC
low complexity region	44	74	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
Pfam:PAM2	128	145	6.8e-5	PFAM
Pfam:MIF4G	164	267	1.9e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173627
AA Change: T349A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134051
Gene: ENSMUSG00000025451
AA Change: T349A

Domain	Start	End	E-Value	Type
Pfam:PAM2	44	61	3.6e-7	PFAM
MIF4G	80	297	2.62e-46	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000174533
AA Change: D189G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134365
Gene: ENSMUSG00000025451
AA Change: D189G

Domain	Start	End	E-Value	Type
Pfam:MIF4G	49	106	1.4e-8	PFAM

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Paip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02668:Paip1	APN	13	119438071	missense	probably damaging	1.00
IGL02873:Paip1	APN	13	119445812	missense	possibly damaging	0.95
R0517:Paip1	UTSW	13	119447790	missense	probably damaging	1.00
R0791:Paip1	UTSW	13	119430318	missense	possibly damaging	0.69
R0792:Paip1	UTSW	13	119430318	missense	possibly damaging	0.69
R1572:Paip1	UTSW	13	119451784	unclassified	probably benign
R1935:Paip1	UTSW	13	119457014	missense	probably damaging	1.00
R1936:Paip1	UTSW	13	119457014	missense	probably damaging	1.00
R2072:Paip1	UTSW	13	119430262	missense	possibly damaging	0.88
R3827:Paip1	UTSW	13	119430232	start codon destroyed	probably null	0.47
R4082:Paip1	UTSW	13	119457004	missense	probably damaging	1.00
R4092:Paip1	UTSW	13	119449913	missense	probably benign	0.02
R4854:Paip1	UTSW	13	119449889	splice site	probably benign
R5012:Paip1	UTSW	13	119447802	missense	probably benign
R5103:Paip1	UTSW	13	119437979	missense	possibly damaging	0.95
R5425:Paip1	UTSW	13	119430166	missense	possibly damaging	0.60
R5592:Paip1	UTSW	13	119450798	missense	probably damaging	1.00
R5851:Paip1	UTSW	13	119440765	missense	possibly damaging	0.94
R5929:Paip1	UTSW	13	119445790	missense	probably damaging	1.00
R5976:Paip1	UTSW	13	119456997	missense	probably damaging	1.00
R6021:Paip1	UTSW	13	119457135	frame shift	probably null
R6326:Paip1	UTSW	13	119430217	missense	probably benign	0.00
R6964:Paip1	UTSW	13	119450770	missense	possibly damaging	0.61
R7544:Paip1	UTSW	13	119445801	missense	probably damaging	1.00
R7552:Paip1	UTSW	13	119440820	missense	possibly damaging	0.83
R7659:Paip1	UTSW	13	119450770	missense	possibly damaging	0.61
R7660:Paip1	UTSW	13	119450770	missense	possibly damaging	0.61
R7661:Paip1	UTSW	13	119450770	missense	possibly damaging	0.61
R7984:Paip1	UTSW	13	119430162	nonsense	probably null
R8294:Paip1	UTSW	13	119450764	missense	possibly damaging	0.95
R8884:Paip1	UTSW	13	119438017	missense	probably damaging	1.00
R8888:Paip1	UTSW	13	119430265	missense	probably benign	0.02
R8895:Paip1	UTSW	13	119430265	missense	probably benign	0.02
R9315:Paip1	UTSW	13	119449980	missense	probably benign	0.24
Z1177:Paip1	UTSW	13	119447808	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AGCTTTCTGTTACACAAGTCTGGCTTC -3'
(R):5'- AAGTCTGACACAGTTTCTTGCTTTCCT -3'

Sequencing Primer
(F):5'- ACCCGTCTTTGTGAGAAATAGCC -3'
(R):5'- TGTGTTCTTCTAAATCCCCATACC -3'

Posted On

2014-03-14