Incidental Mutation 'R1419:Snai2'
ID 160008
Institutional Source Beutler Lab
Gene Symbol Snai2
Ensembl Gene ENSMUSG00000022676
Gene Name snail family zinc finger 2
Synonyms Snail2, Slug, Slugh
MMRRC Submission 039475-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.874) question?
Stock # R1419 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 14705852-14709385 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 14708180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 232 (H232Y)
Ref Sequence ENSEMBL: ENSMUSP00000023356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023356]
AlphaFold P97469
Predicted Effect possibly damaging
Transcript: ENSMUST00000023356
AA Change: H232Y

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023356
Gene: ENSMUSG00000022676
AA Change: H232Y

DomainStartEndE-ValueType
PDB:3W5K|B 1 59 4e-6 PDB
low complexity region 60 84 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
ZnF_C2H2 129 151 4.17e-3 SMART
ZnF_C2H2 160 182 6.88e-4 SMART
ZnF_C2H2 186 208 7.26e-3 SMART
ZnF_C2H2 214 236 9.88e-5 SMART
ZnF_C2H2 242 269 6.15e1 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snail family of C2H2-type zinc finger transcription factors. The encoded protein acts as a transcriptional repressor that binds to E-box motifs and is also likely to repress E-cadherin transcription in breast carcinoma. This protein is involved in epithelial-mesenchymal transitions and has antiapoptotic activity. Mutations in this gene may be associated with sporatic cases of neural tube defects. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in growth retardation and eyelid deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,374,902 M894K probably benign Het
Ablim1 C A 19: 57,134,633 C173F probably damaging Het
Abtb2 G T 2: 103,709,420 R710L probably benign Het
AI481877 T C 4: 59,064,457 T826A possibly damaging Het
Arap3 T C 18: 37,978,432 T1144A possibly damaging Het
Arhgef12 A T 9: 43,027,220 V92D probably damaging Het
Ash1l T G 3: 88,984,897 M1361R probably damaging Het
Atm A C 9: 53,457,489 N2337K probably benign Het
Cog7 T C 7: 121,955,992 E316G probably damaging Het
Dsp A G 13: 38,186,695 Y858C probably damaging Het
Enc1 G T 13: 97,246,184 G401C probably damaging Het
Gata6 T C 18: 11,064,706 V506A probably benign Het
Gm16380 C T 9: 53,884,187 noncoding transcript Het
H2-Ke6 G A 17: 34,027,643 R89C probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift80 T A 3: 68,940,198 N322Y probably damaging Het
Igsf9 T A 1: 172,498,011 V1082E probably damaging Het
Katnal2 A T 18: 76,977,432 L481Q possibly damaging Het
Kcnma1 T C 14: 23,367,642 T713A probably damaging Het
Kif13a T C 13: 46,825,235 T230A probably damaging Het
Klhl14 C A 18: 21,652,193 R59L probably damaging Het
Mecom A G 3: 29,980,889 C213R probably damaging Het
Mrpl13 T A 15: 55,534,321 M178L probably benign Het
Myof T C 19: 37,901,911 E1971G probably damaging Het
Naa10 A G X: 73,917,916 V133A probably damaging Het
Nlrp4g G A 9: 124,349,434 noncoding transcript Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1042 A G 2: 86,159,429 *314Q probably null Het
Olfr1234 T C 2: 89,363,322 T36A probably damaging Het
Olfr1297 A T 2: 111,621,295 F260I probably benign Het
Oplah T C 15: 76,297,920 I1047V probably benign Het
Paip1 A G 13: 119,457,017 D189G probably damaging Het
Pkn1 A G 8: 83,673,522 F624L probably damaging Het
Plxnb1 C A 9: 109,114,386 P1899H probably damaging Het
Rpa3 T A 6: 8,257,720 E47D probably benign Het
Spint5 T C 2: 164,715,411 S23P possibly damaging Het
St8sia2 G A 7: 73,966,994 Q78* probably null Het
Tktl2 A G 8: 66,513,038 N416S probably damaging Het
Tm7sf3 T A 6: 146,603,977 I494F possibly damaging Het
Trf C T 9: 103,226,108 V119M probably damaging Het
Other mutations in Snai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Snai2 APN 16 14706771 missense probably benign 0.02
IGL03295:Snai2 APN 16 14706774 missense possibly damaging 0.64
IGL03412:Snai2 APN 16 14707256 missense possibly damaging 0.91
R0765:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
R0766:Snai2 UTSW 16 14708247 missense possibly damaging 0.71
R1669:Snai2 UTSW 16 14707044 missense possibly damaging 0.95
R2096:Snai2 UTSW 16 14706997 missense possibly damaging 0.86
R2496:Snai2 UTSW 16 14706002 missense possibly damaging 0.86
R2901:Snai2 UTSW 16 14705983 missense possibly damaging 0.93
R4682:Snai2 UTSW 16 14708286 missense probably benign
R4832:Snai2 UTSW 16 14707017 missense probably damaging 0.97
R4879:Snai2 UTSW 16 14706741 missense probably benign
R5025:Snai2 UTSW 16 14708189 missense possibly damaging 0.95
R5794:Snai2 UTSW 16 14706726 missense probably benign
R6143:Snai2 UTSW 16 14708243 nonsense probably null
R6980:Snai2 UTSW 16 14708249 missense possibly damaging 0.92
R7096:Snai2 UTSW 16 14707164 missense possibly damaging 0.93
R7121:Snai2 UTSW 16 14707106 missense probably benign 0.00
R7501:Snai2 UTSW 16 14706890 missense possibly damaging 0.70
R8160:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
R8957:Snai2 UTSW 16 14708249 missense probably damaging 0.97
R9024:Snai2 UTSW 16 14706905 missense probably benign
R9201:Snai2 UTSW 16 14706768 missense probably benign 0.37
R9207:Snai2 UTSW 16 14707082 missense possibly damaging 0.85
R9228:Snai2 UTSW 16 14706928 missense probably damaging 0.96
R9267:Snai2 UTSW 16 14707256 missense possibly damaging 0.91
R9405:Snai2 UTSW 16 14706725 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CAGAACGGAAGCTGTTTGGCTGATA -3'
(R):5'- GGTTTGGCAGCAGTGTAAATCTCTGTA -3'

Sequencing Primer
(F):5'- TAACTGGGGGTTGATATGATCAAGC -3'
(R):5'- ctctctctctctctctctctctc -3'
Posted On 2014-03-14