Incidental Mutation 'R1419:Gata6'
ID160010
Institutional Source Beutler Lab
Gene Symbol Gata6
Ensembl Gene ENSMUSG00000005836
Gene NameGATA binding protein 6
Synonyms
MMRRC Submission 039475-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1419 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location11052508-11085635 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11064706 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 506 (V506A)
Ref Sequence ENSEMBL: ENSMUSP00000041774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047762]
Predicted Effect probably benign
Transcript: ENSMUST00000047762
AA Change: V506A

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041774
Gene: ENSMUSG00000005836
AA Change: V506A

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 84 105 N/A INTRINSIC
Pfam:GATA-N 147 372 2.3e-62 PFAM
ZnF_GATA 378 429 4.23e-16 SMART
ZnF_GATA 432 482 3.62e-24 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a small family of zinc finger transcription factors that play an important role in the regulation of cellular differentiation and organogenesis during vertebrate development. This gene is expressed during early embryogenesis and localizes to endo- and mesodermally derived cells during later embryogenesis and thereby plays an important role in gut, lung, and heart development. Mutations in this gene are associated with several congenital defects. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mutant E5.5 embryos lack parts of the visceral endoderm, show impaired embryonic ectoderm development, and die soon post-implantation, apparently of extraembryonic tissue defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,374,902 M894K probably benign Het
Ablim1 C A 19: 57,134,633 C173F probably damaging Het
Abtb2 G T 2: 103,709,420 R710L probably benign Het
AI481877 T C 4: 59,064,457 T826A possibly damaging Het
Arap3 T C 18: 37,978,432 T1144A possibly damaging Het
Arhgef12 A T 9: 43,027,220 V92D probably damaging Het
Ash1l T G 3: 88,984,897 M1361R probably damaging Het
Atm A C 9: 53,457,489 N2337K probably benign Het
Cog7 T C 7: 121,955,992 E316G probably damaging Het
Dsp A G 13: 38,186,695 Y858C probably damaging Het
Enc1 G T 13: 97,246,184 G401C probably damaging Het
Gm16380 C T 9: 53,884,187 noncoding transcript Het
H2-Ke6 G A 17: 34,027,643 R89C probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift80 T A 3: 68,940,198 N322Y probably damaging Het
Igsf9 T A 1: 172,498,011 V1082E probably damaging Het
Katnal2 A T 18: 76,977,432 L481Q possibly damaging Het
Kcnma1 T C 14: 23,367,642 T713A probably damaging Het
Kif13a T C 13: 46,825,235 T230A probably damaging Het
Klhl14 C A 18: 21,652,193 R59L probably damaging Het
Mecom A G 3: 29,980,889 C213R probably damaging Het
Mrpl13 T A 15: 55,534,321 M178L probably benign Het
Myof T C 19: 37,901,911 E1971G probably damaging Het
Naa10 A G X: 73,917,916 V133A probably damaging Het
Nlrp4g G A 9: 124,349,434 noncoding transcript Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1042 A G 2: 86,159,429 *314Q probably null Het
Olfr1234 T C 2: 89,363,322 T36A probably damaging Het
Olfr1297 A T 2: 111,621,295 F260I probably benign Het
Oplah T C 15: 76,297,920 I1047V probably benign Het
Paip1 A G 13: 119,457,017 D189G probably damaging Het
Pkn1 A G 8: 83,673,522 F624L probably damaging Het
Plxnb1 C A 9: 109,114,386 P1899H probably damaging Het
Rpa3 T A 6: 8,257,720 E47D probably benign Het
Snai2 C T 16: 14,708,180 H232Y possibly damaging Het
Spint5 T C 2: 164,715,411 S23P possibly damaging Het
St8sia2 G A 7: 73,966,994 Q78* probably null Het
Tktl2 A G 8: 66,513,038 N416S probably damaging Het
Tm7sf3 T A 6: 146,603,977 I494F possibly damaging Het
Trf C T 9: 103,226,108 V119M probably damaging Het
Other mutations in Gata6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Gata6 APN 18 11084330 missense possibly damaging 0.47
IGL01328:Gata6 APN 18 11064530 missense probably damaging 0.99
IGL02419:Gata6 APN 18 11054220 missense probably damaging 1.00
lutsen UTSW 18 11063059 missense possibly damaging 0.65
R0538:Gata6 UTSW 18 11064771 missense probably benign 0.11
R2000:Gata6 UTSW 18 11054113 missense probably benign 0.04
R3113:Gata6 UTSW 18 11063124 missense probably damaging 1.00
R4765:Gata6 UTSW 18 11054394 missense probably benign
R4855:Gata6 UTSW 18 11054497 missense possibly damaging 0.92
R5368:Gata6 UTSW 18 11063059 missense possibly damaging 0.65
R6805:Gata6 UTSW 18 11054460 missense possibly damaging 0.83
R7192:Gata6 UTSW 18 11054475 missense possibly damaging 0.82
R7206:Gata6 UTSW 18 11054850 missense probably damaging 1.00
R7501:Gata6 UTSW 18 11054082 missense probably damaging 0.97
R7541:Gata6 UTSW 18 11059108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCCTCGACCACTTGCTATG -3'
(R):5'- TGGGATTAATGACTGCTGGAAGCTG -3'

Sequencing Primer
(F):5'- TCGACCACTTGCTATGAAAAAAG -3'
(R):5'- ggaaggagggagagaggg -3'
Posted On2014-03-14