Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Klhl14'

160011

Institutional Source

Beutler Lab

Gene Symbol

Klhl14

Ensembl Gene

ENSMUSG00000042514

Gene Name

kelch-like 14

Synonyms

printor, 6330403N15Rik

MMRRC Submission

039475-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21550377-21654718 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 21652193 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 59 (R59L)

Ref Sequence

ENSEMBL: ENSMUSP00000113755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049105] [ENSMUST00000122333]

AlphaFold

Q69ZK5

Predicted Effect

probably damaging
Transcript: ENSMUST00000049105
AA Change: R59L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000042015
Gene: ENSMUSG00000042514
AA Change: R59L

Domain	Start	End	E-Value	Type
BTB	33	183	6.57e-25	SMART
BACK	191	281	2.61e-9	SMART
Kelch	325	374	1.63e-1	SMART
Kelch	375	426	3.66e-2	SMART
Kelch	427	473	5.05e-14	SMART
Kelch	474	520	1.79e-5	SMART
Kelch	521	572	3.06e-4	SMART
Kelch	573	622	5.29e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000122333
AA Change: R59L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113755
Gene: ENSMUSG00000042514
AA Change: R59L

Domain	Start	End	E-Value	Type
BTB	33	183	6.57e-25	SMART
BACK	191	281	2.61e-9	SMART
Kelch	325	374	1.63e-1	SMART
Kelch	375	426	3.66e-2	SMART
Kelch	427	473	5.05e-14	SMART
Kelch	474	520	1.79e-5	SMART
Kelch	521	572	3.06e-4	SMART
Kelch	573	622	5.29e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132729

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139804

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143378

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144487

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kelch-like gene family, whose members contain a BTB/POZ domain, a BACK domain, and several Kelch domains. The encoded protein possesses six Kelch domains and localizes to the endoplasmic reticulum, where it interacts with torsin-1A. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Klhl14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Klhl14	APN	18	21651864	missense	probably benign	0.00
IGL01474:Klhl14	APN	18	21557854	missense	probably damaging	0.99
IGL02005:Klhl14	APN	18	21624611	nonsense	probably null
IGL02108:Klhl14	APN	18	21557920	missense	probably damaging	0.98
IGL02371:Klhl14	APN	18	21652181	missense	probably damaging	1.00
IGL03354:Klhl14	APN	18	21651728	missense	probably damaging	1.00
P0027:Klhl14	UTSW	18	21558135	missense	probably damaging	1.00
PIT4810001:Klhl14	UTSW	18	21557823	nonsense	probably null
R0288:Klhl14	UTSW	18	21565563	missense	probably damaging	1.00
R1606:Klhl14	UTSW	18	21565532	missense	possibly damaging	0.94
R1771:Klhl14	UTSW	18	21651620	missense	probably damaging	0.97
R1928:Klhl14	UTSW	18	21651786	missense	probably damaging	1.00
R1966:Klhl14	UTSW	18	21554673	missense	probably damaging	1.00
R3624:Klhl14	UTSW	18	21557896	missense	probably damaging	1.00
R4541:Klhl14	UTSW	18	21554639	nonsense	probably null
R4664:Klhl14	UTSW	18	21554708	missense	probably benign	0.06
R4856:Klhl14	UTSW	18	21557972	splice site	probably null
R4886:Klhl14	UTSW	18	21557972	splice site	probably null
R4893:Klhl14	UTSW	18	21557935	missense	probably damaging	1.00
R5393:Klhl14	UTSW	18	21651994	missense	probably benign	0.30
R5757:Klhl14	UTSW	18	21554734	missense	probably damaging	1.00
R5951:Klhl14	UTSW	18	21651620	missense	probably damaging	0.97
R5958:Klhl14	UTSW	18	21565535	missense	probably damaging	0.99
R7231:Klhl14	UTSW	18	21652136	missense	probably damaging	0.99
R7519:Klhl14	UTSW	18	21651843	missense	probably benign	0.36
R7527:Klhl14	UTSW	18	21651540	missense	probably damaging	0.99
R7573:Klhl14	UTSW	18	21652154	missense	probably benign	0.00
R7664:Klhl14	UTSW	18	21554649	missense	probably damaging	1.00
R7737:Klhl14	UTSW	18	21558134	nonsense	probably null
R8079:Klhl14	UTSW	18	21651965	missense	probably benign	0.39
R8889:Klhl14	UTSW	18	21558163	missense	possibly damaging	0.56
R8892:Klhl14	UTSW	18	21558163	missense	possibly damaging	0.56
T0722:Klhl14	UTSW	18	21558135	missense	probably damaging	1.00
X0026:Klhl14	UTSW	18	21651941	missense	possibly damaging	0.94
Z1177:Klhl14	UTSW	18	21652104	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CACGTTGGCTGTGTAGAGGTATTCAAG -3'
(R):5'- TTGCTGCCAAGAGAGAAGCCTG -3'

Sequencing Primer
(F):5'- TATTCAAGCACTAGGCGCAG -3'
(R):5'- accacaccacaccccac -3'

Posted On

2014-03-14