Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Arap3'

160012

Institutional Source

Beutler Lab

Gene Symbol

Arap3

Ensembl Gene

ENSMUSG00000024451

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3

Synonyms

DRAG1, E030006K04Rik, Centd3

MMRRC Submission

039475-MU

Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Essential gene?

Probably essential (E-score: 0.877) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37972624-37997574 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37978432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1144 (T1144A)

Ref Sequence

ENSEMBL: ENSMUSP00000035662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042944]

AlphaFold

Q8R5G7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042944
AA Change: T1144A

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: T1144A

Domain	Start	End	E-Value	Type
SAM	1	68	1.5e-7	SMART
low complexity region	81	98	N/A	INTRINSIC
low complexity region	134	142	N/A	INTRINSIC
PH	283	376	3.4e-16	SMART
PH	390	480	1.61e-8	SMART
ArfGap	484	606	1.44e-25	SMART
low complexity region	642	661	N/A	INTRINSIC
PH	671	785	2.86e1	SMART
PH	795	901	6.87e-3	SMART
RhoGAP	913	1089	2.11e-47	SMART
Pfam:RA	1113	1206	6.2e-16	PFAM
PH	1220	1323	3.46e-8	SMART
low complexity region	1388	1407	N/A	INTRINSIC
low complexity region	1457	1469	N/A	INTRINSIC
low complexity region	1475	1486	N/A	INTRINSIC
low complexity region	1494	1529	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184293

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Ablim1	C	A	19: 57,134,633	C173F	probably damaging	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Arap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Arap3	APN	18	37975926	missense	probably damaging	1.00
IGL01145:Arap3	APN	18	37989179	missense	probably benign
IGL01154:Arap3	APN	18	37996734	missense	probably benign	0.28
IGL01305:Arap3	APN	18	37991327	critical splice donor site	probably null
IGL01542:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01543:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01544:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01545:Arap3	APN	18	37990836	missense	probably damaging	0.98
IGL01677:Arap3	APN	18	37996647	missense	probably benign
IGL01925:Arap3	APN	18	37984246	missense	probably benign	0.21
IGL01933:Arap3	APN	18	37978453	missense	possibly damaging	0.65
IGL02048:Arap3	APN	18	37996979	missense	possibly damaging	0.56
IGL02064:Arap3	APN	18	37991701	missense	probably damaging	1.00
IGL02207:Arap3	APN	18	37987853	missense	probably benign	0.00
IGL02376:Arap3	APN	18	37978453	missense	possibly damaging	0.95
IGL02531:Arap3	APN	18	37989751	missense	probably damaging	0.99
IGL02568:Arap3	APN	18	37996658	missense	probably benign	0.32
IGL02640:Arap3	APN	18	37987802	missense	possibly damaging	0.71
IGL02658:Arap3	APN	18	37990994	missense	probably benign	0.09
IGL03090:Arap3	APN	18	37989112	missense	probably benign	0.00
IGL03352:Arap3	APN	18	37981302	splice site	probably benign
ANU22:Arap3	UTSW	18	37991327	critical splice donor site	probably null
P0016:Arap3	UTSW	18	37984348	missense	probably benign	0.00
PIT4260001:Arap3	UTSW	18	37996895	missense	probably benign	0.08
R0066:Arap3	UTSW	18	37996707	missense	probably benign	0.01
R0324:Arap3	UTSW	18	37973225	missense	possibly damaging	0.93
R0562:Arap3	UTSW	18	37975540	missense	probably damaging	1.00
R1289:Arap3	UTSW	18	37981973	missense	possibly damaging	0.95
R1346:Arap3	UTSW	18	37975918	missense	probably damaging	1.00
R1470:Arap3	UTSW	18	37989196	critical splice acceptor site	probably null
R1470:Arap3	UTSW	18	37989196	critical splice acceptor site	probably null
R1537:Arap3	UTSW	18	37989684	critical splice donor site	probably null
R1644:Arap3	UTSW	18	37984245	missense	probably damaging	1.00
R1731:Arap3	UTSW	18	37989912	missense	probably benign	0.01
R1758:Arap3	UTSW	18	37989912	missense	probably benign	0.01
R1843:Arap3	UTSW	18	37975583	missense	probably damaging	1.00
R1907:Arap3	UTSW	18	37996671	missense	probably benign	0.28
R1954:Arap3	UTSW	18	37982002	missense	probably damaging	1.00
R2124:Arap3	UTSW	18	37973350	missense	probably damaging	0.98
R2135:Arap3	UTSW	18	37974456	missense	probably damaging	1.00
R2172:Arap3	UTSW	18	37990560	missense	probably damaging	1.00
R2418:Arap3	UTSW	18	37989944	missense	probably damaging	1.00
R2419:Arap3	UTSW	18	37989944	missense	probably damaging	1.00
R2907:Arap3	UTSW	18	37990527	missense	possibly damaging	0.88
R4425:Arap3	UTSW	18	37978600	missense	probably damaging	1.00
R4669:Arap3	UTSW	18	37996254	missense	probably benign	0.08
R4734:Arap3	UTSW	18	37996275	missense	probably benign	0.00
R4815:Arap3	UTSW	18	37973243	missense	probably benign
R5328:Arap3	UTSW	18	37991687	missense	possibly damaging	0.92
R5350:Arap3	UTSW	18	37982035	missense	probably damaging	1.00
R5466:Arap3	UTSW	18	37996736	missense	probably benign	0.00
R5482:Arap3	UTSW	18	37974674	missense	possibly damaging	0.95
R5572:Arap3	UTSW	18	37991066	missense	probably damaging	1.00
R5779:Arap3	UTSW	18	37984365	missense	probably damaging	1.00
R6053:Arap3	UTSW	18	37990771	missense	probably damaging	0.98
R6144:Arap3	UTSW	18	37985433	missense	probably damaging	0.98
R6166:Arap3	UTSW	18	37974370	missense	probably damaging	1.00
R6248:Arap3	UTSW	18	37991354	missense	probably benign	0.09
R6266:Arap3	UTSW	18	37990791	missense	probably damaging	0.98
R6385:Arap3	UTSW	18	37997031	nonsense	probably null
R6694:Arap3	UTSW	18	37991537	critical splice donor site	probably null
R6856:Arap3	UTSW	18	37979863	missense	possibly damaging	0.95
R7073:Arap3	UTSW	18	37974442	nonsense	probably null
R7297:Arap3	UTSW	18	37973563	missense	possibly damaging	0.81
R7352:Arap3	UTSW	18	37973278	missense	probably benign	0.00
R7652:Arap3	UTSW	18	37978452	missense	probably damaging	0.99
R7726:Arap3	UTSW	18	37989467	missense	probably damaging	0.99
R7747:Arap3	UTSW	18	37988888	splice site	probably null
R7944:Arap3	UTSW	18	37989179	missense	probably benign
R8152:Arap3	UTSW	18	37991357	missense	possibly damaging	0.61
R8338:Arap3	UTSW	18	37973630	missense	probably damaging	0.99
R8549:Arap3	UTSW	18	37973312	missense	probably benign	0.17
R8793:Arap3	UTSW	18	37974439	missense	probably benign	0.04
R8876:Arap3	UTSW	18	37997024	missense	possibly damaging	0.67
R9142:Arap3	UTSW	18	37979881	missense	possibly damaging	0.80
R9237:Arap3	UTSW	18	37979881	missense	possibly damaging	0.80
R9583:Arap3	UTSW	18	37976043	missense	probably damaging	0.97
R9696:Arap3	UTSW	18	37979852	missense	probably damaging	1.00
X0011:Arap3	UTSW	18	37974101	critical splice donor site	probably null
X0026:Arap3	UTSW	18	37985311	critical splice donor site	probably null
X0027:Arap3	UTSW	18	37973485	splice site	probably null
X0066:Arap3	UTSW	18	37991646	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCTTTGCTGAAGCCAAGAGAAGAG -3'
(R):5'- CGCAGCTAAACATTCGTCGTGTTC -3'

Sequencing Primer
(F):5'- tgaagccaagagaagaggattaag -3'
(R):5'- ATCTTGGAGTTCTTACCAAGGC -3'

Posted On

2014-03-14