Incidental Mutation 'R1419:Katnal2'
ID 160013
Institutional Source Beutler Lab
Gene Symbol Katnal2
Ensembl Gene ENSMUSG00000025420
Gene Name katanin p60 subunit A-like 2
Synonyms 4933439B08Rik, 3110023G01Rik
MMRRC Submission 039475-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1419 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 77064844-77135004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77065128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 481 (L481Q)
Ref Sequence ENSEMBL: ENSMUSP00000117495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122984] [ENSMUST00000126153] [ENSMUST00000135029] [ENSMUST00000137354] [ENSMUST00000137498] [ENSMUST00000148955] [ENSMUST00000150990]
AlphaFold Q9D3R6
Predicted Effect probably benign
Transcript: ENSMUST00000122984
Predicted Effect possibly damaging
Transcript: ENSMUST00000126153
AA Change: L525Q

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122079
Gene: ENSMUSG00000025420
AA Change: L525Q

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 425 1.74e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135029
SMART Domains Protein: ENSMUSP00000115411
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 372 2.95e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137354
AA Change: L263Q

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118511
Gene: ENSMUSG00000025420
AA Change: L263Q

DomainStartEndE-ValueType
AAA 25 163 1.74e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137498
AA Change: L481Q

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117495
Gene: ENSMUSG00000025420
AA Change: L481Q

DomainStartEndE-ValueType
AAA 243 381 1.74e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148955
SMART Domains Protein: ENSMUSP00000116243
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154053
Predicted Effect probably benign
Transcript: ENSMUST00000150990
SMART Domains Protein: ENSMUSP00000114212
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,974,125 (GRCm39) M894K probably benign Het
Ablim1 C A 19: 57,123,065 (GRCm39) C173F probably damaging Het
Abtb2 G T 2: 103,539,765 (GRCm39) R710L probably benign Het
Arap3 T C 18: 38,111,485 (GRCm39) T1144A possibly damaging Het
Arhgef12 A T 9: 42,938,516 (GRCm39) V92D probably damaging Het
Ash1l T G 3: 88,892,204 (GRCm39) M1361R probably damaging Het
Atm A C 9: 53,368,789 (GRCm39) N2337K probably benign Het
Cog7 T C 7: 121,555,215 (GRCm39) E316G probably damaging Het
Dsp A G 13: 38,370,671 (GRCm39) Y858C probably damaging Het
Enc1 G T 13: 97,382,692 (GRCm39) G401C probably damaging Het
Gata6 T C 18: 11,064,706 (GRCm39) V506A probably benign Het
Gm16380 C T 9: 53,791,471 (GRCm39) noncoding transcript Het
Hsd17b8 G A 17: 34,246,617 (GRCm39) R89C probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ift80 T A 3: 68,847,531 (GRCm39) N322Y probably damaging Het
Igsf9 T A 1: 172,325,578 (GRCm39) V1082E probably damaging Het
Kcnma1 T C 14: 23,417,710 (GRCm39) T713A probably damaging Het
Kif13a T C 13: 46,978,711 (GRCm39) T230A probably damaging Het
Klhl14 C A 18: 21,785,250 (GRCm39) R59L probably damaging Het
Mecom A G 3: 30,035,038 (GRCm39) C213R probably damaging Het
Mrpl13 T A 15: 55,397,717 (GRCm39) M178L probably benign Het
Myof T C 19: 37,890,359 (GRCm39) E1971G probably damaging Het
Naa10 A G X: 72,961,522 (GRCm39) V133A probably damaging Het
Nlrp4g G A 9: 124,349,434 (GRCm38) noncoding transcript Het
Ofcc1 C T 13: 40,362,305 (GRCm39) G206R probably benign Het
Oplah T C 15: 76,182,120 (GRCm39) I1047V probably benign Het
Or4a15 T C 2: 89,193,666 (GRCm39) T36A probably damaging Het
Or4k47 A T 2: 111,451,640 (GRCm39) F260I probably benign Het
Or5al1 A G 2: 85,989,773 (GRCm39) *314Q probably null Het
Paip1 A G 13: 119,593,553 (GRCm39) D189G probably damaging Het
Pkn1 A G 8: 84,400,151 (GRCm39) F624L probably damaging Het
Plxnb1 C A 9: 108,943,454 (GRCm39) P1899H probably damaging Het
Rpa3 T A 6: 8,257,720 (GRCm39) E47D probably benign Het
Shoc1 T C 4: 59,064,457 (GRCm39) T826A possibly damaging Het
Snai2 C T 16: 14,526,044 (GRCm39) H232Y possibly damaging Het
Spint5 T C 2: 164,557,331 (GRCm39) S23P possibly damaging Het
St8sia2 G A 7: 73,616,742 (GRCm39) Q78* probably null Het
Tktl2 A G 8: 66,965,690 (GRCm39) N416S probably damaging Het
Tm7sf3 T A 6: 146,505,475 (GRCm39) I494F possibly damaging Het
Trf C T 9: 103,103,307 (GRCm39) V119M probably damaging Het
Other mutations in Katnal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Katnal2 APN 18 77,090,450 (GRCm39) missense probably damaging 1.00
IGL00976:Katnal2 APN 18 77,105,189 (GRCm39) missense probably damaging 1.00
IGL01012:Katnal2 APN 18 77,105,250 (GRCm39) missense probably damaging 0.96
IGL01302:Katnal2 APN 18 77,134,863 (GRCm39) splice site probably benign
IGL01377:Katnal2 APN 18 77,090,153 (GRCm39) missense probably damaging 1.00
IGL01532:Katnal2 APN 18 77,099,696 (GRCm39) missense probably benign
IGL03203:Katnal2 APN 18 77,095,220 (GRCm39) missense probably damaging 1.00
R0592:Katnal2 UTSW 18 77,090,256 (GRCm39) splice site probably null
R1348:Katnal2 UTSW 18 77,066,238 (GRCm39) splice site probably null
R1755:Katnal2 UTSW 18 77,099,763 (GRCm39) missense probably benign 0.01
R1772:Katnal2 UTSW 18 77,090,233 (GRCm39) missense probably damaging 1.00
R1852:Katnal2 UTSW 18 77,103,719 (GRCm39) missense probably benign 0.08
R1952:Katnal2 UTSW 18 77,067,707 (GRCm39) missense probably benign 0.00
R2115:Katnal2 UTSW 18 77,067,787 (GRCm39) missense probably damaging 1.00
R2155:Katnal2 UTSW 18 77,098,637 (GRCm39) missense probably benign 0.01
R4765:Katnal2 UTSW 18 77,065,239 (GRCm39) splice site probably null
R5126:Katnal2 UTSW 18 77,105,294 (GRCm39) missense probably benign 0.13
R5141:Katnal2 UTSW 18 77,085,337 (GRCm39) missense probably damaging 1.00
R5315:Katnal2 UTSW 18 77,099,705 (GRCm39) missense probably benign 0.02
R5358:Katnal2 UTSW 18 77,105,190 (GRCm39) missense possibly damaging 0.47
R5412:Katnal2 UTSW 18 77,090,131 (GRCm39) missense probably damaging 1.00
R6289:Katnal2 UTSW 18 77,105,151 (GRCm39) splice site probably null
R6647:Katnal2 UTSW 18 77,067,733 (GRCm39) missense probably benign 0.01
R6919:Katnal2 UTSW 18 77,098,734 (GRCm39) missense probably benign 0.05
R7039:Katnal2 UTSW 18 77,134,868 (GRCm39) critical splice donor site probably null
R7285:Katnal2 UTSW 18 77,081,271 (GRCm39) missense probably benign 0.20
Z1176:Katnal2 UTSW 18 77,099,753 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTGACATCCATGACACGAGAG -3'
(R):5'- GCTTTAAGCTCCATAGCCCCATCAC -3'

Sequencing Primer
(F):5'- GCTCATGTTTCCAaaggaacacag -3'
(R):5'- ACAGGATGTCTGCACTGTC -3'
Posted On 2014-03-14