Mutagenetix > Incidental Mutation

Incidental Mutation 'R1419:Ablim1'

160015

Institutional Source

Beutler Lab

Gene Symbol

Ablim1

Ensembl Gene

ENSMUSG00000025085

Gene Name

actin-binding LIM protein 1

Synonyms

2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1

MMRRC Submission

039475-MU

Accession Numbers

Genbank: NM_178688; MGI: 1194500

Essential gene?

Possibly non essential (E-score: 0.440) question?

Stock #

R1419 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57032733-57314919 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 57134633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 173 (C173F)

Ref Sequence

ENSEMBL: ENSMUSP00000107149 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000111524] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000079360
AA Change: C250F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085
AA Change: C250F

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
LIM	98	149	1.14e-9	SMART
LIM	157	209	1.37e-12	SMART
LIM	225	276	1.12e-17	SMART
LIM	284	336	5.87e-12	SMART
Pfam:AbLIM_anchor	393	825	1.9e-139	PFAM
VHP	826	861	1.22e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000099294
AA Change: C174F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085
AA Change: C174F

Domain	Start	End	E-Value	Type
LIM	22	73	1.14e-9	SMART
LIM	81	133	1.37e-12	SMART
LIM	149	200	1.12e-17	SMART
LIM	208	260	5.87e-12	SMART
low complexity region	284	293	N/A	INTRINSIC
coiled coil region	467	491	N/A	INTRINSIC
low complexity region	516	531	N/A	INTRINSIC
VHP	619	654	1.22e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111524
AA Change: C173F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107149
Gene: ENSMUSG00000025085
AA Change: C173F

Domain	Start	End	E-Value	Type
LIM	21	72	1.14e-9	SMART
LIM	80	132	1.37e-12	SMART
LIM	148	199	1.12e-17	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111544
AA Change: C174F

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085
AA Change: C174F

Domain	Start	End	E-Value	Type
LIM	22	73	1.14e-9	SMART
LIM	81	133	1.37e-12	SMART
LIM	149	200	1.12e-17	SMART
LIM	208	260	5.87e-12	SMART
low complexity region	284	293	N/A	INTRINSIC
low complexity region	422	427	N/A	INTRINSIC
coiled coil region	481	505	N/A	INTRINSIC
low complexity region	530	545	N/A	INTRINSIC
VHP	633	668	1.22e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111546
AA Change: C174F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085
AA Change: C174F

Domain	Start	End	E-Value	Type
LIM	22	73	5.7e-12	SMART
LIM	81	133	6.6e-15	SMART
LIM	149	200	5.4e-20	SMART
LIM	208	260	2.8e-14	SMART
low complexity region	284	293	N/A	INTRINSIC
coiled coil region	514	538	N/A	INTRINSIC
low complexity region	563	578	N/A	INTRINSIC
VHP	666	700	1.2e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111550
AA Change: C174F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085
AA Change: C174F

Domain	Start	End	E-Value	Type
LIM	22	73	1.14e-9	SMART
LIM	81	133	1.37e-12	SMART
LIM	149	200	1.12e-17	SMART
LIM	208	260	5.87e-12	SMART
low complexity region	312	321	N/A	INTRINSIC
coiled coil region	495	519	N/A	INTRINSIC
low complexity region	544	559	N/A	INTRINSIC
VHP	647	682	1.22e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111555
AA Change: C250F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085
AA Change: C250F

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
LIM	98	149	1.14e-9	SMART
LIM	157	209	1.37e-12	SMART
LIM	225	276	1.12e-17	SMART
LIM	284	336	5.87e-12	SMART
low complexity region	360	369	N/A	INTRINSIC
coiled coil region	590	614	N/A	INTRINSIC
low complexity region	639	654	N/A	INTRINSIC
VHP	742	777	1.22e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111558
AA Change: C187F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085
AA Change: C187F

Domain	Start	End	E-Value	Type
LIM	35	86	1.14e-9	SMART
LIM	94	146	1.37e-12	SMART
LIM	162	213	1.12e-17	SMART
LIM	221	273	5.87e-12	SMART
low complexity region	325	334	N/A	INTRINSIC
low complexity region	498	503	N/A	INTRINSIC
coiled coil region	557	581	N/A	INTRINSIC
low complexity region	606	621	N/A	INTRINSIC
VHP	709	744	1.22e-17	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111559
AA Change: C187F

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085
AA Change: C187F

Domain	Start	End	E-Value	Type
LIM	35	86	1.14e-9	SMART
LIM	94	146	1.37e-12	SMART
LIM	162	213	1.12e-17	SMART
LIM	221	273	5.87e-12	SMART
low complexity region	297	306	N/A	INTRINSIC
coiled coil region	527	551	N/A	INTRINSIC
low complexity region	576	591	N/A	INTRINSIC
VHP	679	714	1.22e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128212

Predicted Effect

unknown
Transcript: ENSMUST00000133369
AA Change: C196F

SMART Domains

Protein: ENSMUSP00000117798
Gene: ENSMUSG00000025085
AA Change: C196F

Domain	Start	End	E-Value	Type
LIM	45	96	1.14e-9	SMART
LIM	104	156	1.37e-12	SMART
LIM	172	223	1.12e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134430

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156316

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133782

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,374,902	M894K	probably benign	Het
Abtb2	G	T	2: 103,709,420	R710L	probably benign	Het
AI481877	T	C	4: 59,064,457	T826A	possibly damaging	Het
Arap3	T	C	18: 37,978,432	T1144A	possibly damaging	Het
Arhgef12	A	T	9: 43,027,220	V92D	probably damaging	Het
Ash1l	T	G	3: 88,984,897	M1361R	probably damaging	Het
Atm	A	C	9: 53,457,489	N2337K	probably benign	Het
Cog7	T	C	7: 121,955,992	E316G	probably damaging	Het
Dsp	A	G	13: 38,186,695	Y858C	probably damaging	Het
Enc1	G	T	13: 97,246,184	G401C	probably damaging	Het
Gata6	T	C	18: 11,064,706	V506A	probably benign	Het
Gm16380	C	T	9: 53,884,187		noncoding transcript	Het
H2-Ke6	G	A	17: 34,027,643	R89C	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Ift80	T	A	3: 68,940,198	N322Y	probably damaging	Het
Igsf9	T	A	1: 172,498,011	V1082E	probably damaging	Het
Katnal2	A	T	18: 76,977,432	L481Q	possibly damaging	Het
Kcnma1	T	C	14: 23,367,642	T713A	probably damaging	Het
Kif13a	T	C	13: 46,825,235	T230A	probably damaging	Het
Klhl14	C	A	18: 21,652,193	R59L	probably damaging	Het
Mecom	A	G	3: 29,980,889	C213R	probably damaging	Het
Mrpl13	T	A	15: 55,534,321	M178L	probably benign	Het
Myof	T	C	19: 37,901,911	E1971G	probably damaging	Het
Naa10	A	G	X: 73,917,916	V133A	probably damaging	Het
Nlrp4g	G	A	9: 124,349,434		noncoding transcript	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1042	A	G	2: 86,159,429	*314Q	probably null	Het
Olfr1234	T	C	2: 89,363,322	T36A	probably damaging	Het
Olfr1297	A	T	2: 111,621,295	F260I	probably benign	Het
Oplah	T	C	15: 76,297,920	I1047V	probably benign	Het
Paip1	A	G	13: 119,457,017	D189G	probably damaging	Het
Pkn1	A	G	8: 83,673,522	F624L	probably damaging	Het
Plxnb1	C	A	9: 109,114,386	P1899H	probably damaging	Het
Rpa3	T	A	6: 8,257,720	E47D	probably benign	Het
Snai2	C	T	16: 14,708,180	H232Y	possibly damaging	Het
Spint5	T	C	2: 164,715,411	S23P	possibly damaging	Het
St8sia2	G	A	7: 73,966,994	Q78*	probably null	Het
Tktl2	A	G	8: 66,513,038	N416S	probably damaging	Het
Tm7sf3	T	A	6: 146,603,977	I494F	possibly damaging	Het
Trf	C	T	9: 103,226,108	V119M	probably damaging	Het

Other mutations in Ablim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Ablim1	APN	19	57068186	missense	probably damaging	1.00
IGL00466:Ablim1	APN	19	57068186	missense	probably damaging	1.00
IGL00478:Ablim1	APN	19	57068186	missense	probably damaging	1.00
IGL00847:Ablim1	APN	19	57152290	missense	possibly damaging	0.59
IGL01063:Ablim1	APN	19	57061328	missense	probably damaging	1.00
IGL01304:Ablim1	APN	19	57215721	missense	probably benign
IGL01385:Ablim1	APN	19	57068914	missense	probably damaging	1.00
IGL01707:Ablim1	APN	19	57039447	missense	probably damaging	1.00
IGL02386:Ablim1	APN	19	57134654	missense	probably damaging	1.00
IGL02427:Ablim1	APN	19	57079880	splice site	probably benign
IGL02498:Ablim1	APN	19	57152319	nonsense	probably null
A9681:Ablim1	UTSW	19	57173323	critical splice donor site	probably null
R0089:Ablim1	UTSW	19	57043031	missense	probably damaging	1.00
R0226:Ablim1	UTSW	19	57043870	missense	probably damaging	1.00
R1473:Ablim1	UTSW	19	57068236	missense	probably damaging	1.00
R1587:Ablim1	UTSW	19	57083547	start codon destroyed	probably null	0.99
R1588:Ablim1	UTSW	19	57083547	start codon destroyed	probably null	0.99
R1935:Ablim1	UTSW	19	57215965	start gained	probably null
R1936:Ablim1	UTSW	19	57215965	start gained	probably null
R2021:Ablim1	UTSW	19	57047018	missense	probably damaging	0.98
R2110:Ablim1	UTSW	19	57043813	missense	possibly damaging	0.83
R2270:Ablim1	UTSW	19	57077431	missense	possibly damaging	0.58
R2509:Ablim1	UTSW	19	57152359	missense	probably damaging	1.00
R3621:Ablim1	UTSW	19	57152303	missense	probably damaging	0.97
R3732:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3732:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3733:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3734:Ablim1	UTSW	19	57049460	critical splice donor site	probably null
R3878:Ablim1	UTSW	19	57037210	splice site	probably null
R4354:Ablim1	UTSW	19	57155278	missense	probably damaging	1.00
R4543:Ablim1	UTSW	19	57077442	missense	possibly damaging	0.87
R4749:Ablim1	UTSW	19	57215721	missense	probably benign
R4860:Ablim1	UTSW	19	57079866	missense	probably damaging	1.00
R4860:Ablim1	UTSW	19	57079866	missense	probably damaging	1.00
R5072:Ablim1	UTSW	19	57073853	critical splice donor site	probably null
R5277:Ablim1	UTSW	19	57155261	missense	probably damaging	1.00
R5331:Ablim1	UTSW	19	57155249	missense	probably damaging	1.00
R5354:Ablim1	UTSW	19	57130923	missense	probably benign	0.07
R5893:Ablim1	UTSW	19	57215853	missense	probably benign	0.07
R5958:Ablim1	UTSW	19	57041935	missense	probably damaging	1.00
R6435:Ablim1	UTSW	19	57061355	missense	possibly damaging	0.69
R6460:Ablim1	UTSW	19	57079839	missense	possibly damaging	0.96
R6642:Ablim1	UTSW	19	57130852	missense	probably benign	0.03
R6662:Ablim1	UTSW	19	57073853	critical splice donor site	probably null
R6705:Ablim1	UTSW	19	57215821	missense	probably benign	0.01
R7111:Ablim1	UTSW	19	57073877	missense	probably benign	0.05
R7291:Ablim1	UTSW	19	57215908	missense	probably benign
R7363:Ablim1	UTSW	19	57215741	missense	probably benign	0.10
R7901:Ablim1	UTSW	19	57131002	splice site	probably null
R7974:Ablim1	UTSW	19	57044973	critical splice acceptor site	probably null
R8079:Ablim1	UTSW	19	57182224	critical splice donor site	probably null
R8087:Ablim1	UTSW	19	57182256	missense
R8120:Ablim1	UTSW	19	57046928	missense	probably benign	0.00
R8277:Ablim1	UTSW	19	57215919	missense	probably benign	0.10
R8339:Ablim1	UTSW	19	57043849	missense	probably benign	0.00
R8536:Ablim1	UTSW	19	57182286	intron	probably benign
R8857:Ablim1	UTSW	19	57130855	missense	possibly damaging	0.84
R8875:Ablim1	UTSW	19	57130954	missense	probably benign	0.00
R8983:Ablim1	UTSW	19	57239212	missense	probably benign	0.02
R9055:Ablim1	UTSW	19	57041966	missense	probably benign	0.10
R9475:Ablim1	UTSW	19	57239180	missense	probably benign	0.00
R9505:Ablim1	UTSW	19	57197350	intron	probably benign
R9695:Ablim1	UTSW	19	57182307	missense
R9762:Ablim1	UTSW	19	57037259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCCATTAAGTTTACAGCAGCCAC -3'
(R):5'- TGAGACCTTAGTCAAGAGCCGCAC -3'

Sequencing Primer
(F):5'- TGTTCATACTGATGCAAGACGG -3'
(R):5'- TCCAGGGAAATGGCAGTAAC -3'

Posted On

2014-03-14