Incidental Mutation 'R1420:Ints7'
ID160021
Institutional Source Beutler Lab
Gene Symbol Ints7
Ensembl Gene ENSMUSG00000037461
Gene Nameintegrator complex subunit 7
Synonyms5930412E23Rik
MMRRC Submission 039476-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R1420 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191575636-191623688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 191613057 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 620 (F620V)
Ref Sequence ENSEMBL: ENSMUSP00000036277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000193569] [ENSMUST00000194785] [ENSMUST00000194877]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045450
AA Change: F620V

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461
AA Change: F620V

DomainStartEndE-ValueType
SCOP:d1gw5a_ 76 530 1e-10 SMART
low complexity region 937 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193961
Predicted Effect probably benign
Transcript: ENSMUST00000194785
Predicted Effect probably benign
Transcript: ENSMUST00000194877
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,495,935 Y669H probably damaging Het
Amotl2 A T 9: 102,724,783 M409L possibly damaging Het
Ankrd35 A G 3: 96,684,738 E780G probably benign Het
Brwd1 T C 16: 96,036,034 Y866C probably damaging Het
Cul4b G C X: 38,565,041 probably null Het
Daw1 A T 1: 83,159,827 Y10F possibly damaging Het
Dgki A T 6: 37,050,269 probably null Het
Dnah3 A T 7: 119,951,979 V3039E probably damaging Het
Ercc4 C T 16: 13,130,209 T340I probably benign Het
Fam83b T C 9: 76,492,612 N403S possibly damaging Het
Fbxo18 A G 2: 11,767,682 F63L probably benign Het
Foxm1 G A 6: 128,372,921 R395H possibly damaging Het
Gtpbp4 C T 13: 8,973,262 A589T probably benign Het
Ifna7 C A 4: 88,816,669 H148N probably damaging Het
Il23r T C 6: 67,486,197 Y104C probably damaging Het
Il31ra A T 13: 112,531,752 W347R probably damaging Het
Iqcd T C 5: 120,600,795 L226P probably damaging Het
Jak3 G T 8: 71,681,538 R428L possibly damaging Het
Kif28 C A 1: 179,702,397 C733F probably damaging Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Ksr2 A G 5: 117,414,839 E4G probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lrriq3 A G 3: 155,187,712 E350G probably benign Het
Nav3 G A 10: 109,823,254 A834V probably benign Het
Ncoa6 G A 2: 155,421,153 Q454* probably null Het
Nfatc2 C A 2: 168,504,665 M836I probably benign Het
Nphp3 G T 9: 104,035,893 probably null Het
Olfml2b C T 1: 170,669,027 T409M probably benign Het
Olfr955 A T 9: 39,469,993 H244Q probably damaging Het
Oprk1 A G 1: 5,602,321 K227R probably damaging Het
Pate1 A T 9: 35,685,209 W87R probably damaging Het
Pcnx4 T C 12: 72,555,986 Y341H probably benign Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pglyrp4 T C 3: 90,728,714 V82A probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Prdm9 C A 17: 15,544,376 C714F probably damaging Het
Pwp1 T C 10: 85,876,538 V80A probably damaging Het
Pxdn T C 12: 30,002,068 L568P probably damaging Het
Rasgrp4 C A 7: 29,140,345 Q161K probably damaging Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Slc16a6 A G 11: 109,454,946 V413A probably damaging Het
Slc7a15 T C 12: 8,534,442 T363A probably benign Het
Sufu T C 19: 46,397,184 S28P probably benign Het
Tex19.1 T C 11: 121,147,046 S77P probably damaging Het
Tmc7 A T 7: 118,566,217 Y91* probably null Het
Ttbk2 C G 2: 120,745,912 R792S probably benign Het
Tyw1 T C 5: 130,274,745 probably null Het
U2surp A G 9: 95,462,803 S907P probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vps50 T A 6: 3,588,007 L660* probably null Het
Wdr55 A G 18: 36,760,339 E18G probably benign Het
Wipi1 A G 11: 109,578,372 V331A probably benign Het
Other mutations in Ints7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ints7 APN 1 191596164 splice site probably null
IGL01285:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01289:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01572:Ints7 APN 1 191615793 missense possibly damaging 0.71
IGL01665:Ints7 APN 1 191613219 splice site probably benign
IGL02059:Ints7 APN 1 191615760 missense probably benign 0.23
IGL02684:Ints7 APN 1 191613637 critical splice acceptor site probably null
IGL02686:Ints7 APN 1 191586592 missense probably damaging 1.00
IGL02812:Ints7 APN 1 191619741 missense probably damaging 1.00
IGL03119:Ints7 APN 1 191610365 missense probably damaging 1.00
IGL03162:Ints7 APN 1 191621412 utr 3 prime probably benign
PIT4810001:Ints7 UTSW 1 191596236 missense probably damaging 0.99
R0294:Ints7 UTSW 1 191611891 missense possibly damaging 0.91
R0479:Ints7 UTSW 1 191614554 intron probably null
R0698:Ints7 UTSW 1 191594464 missense probably damaging 0.97
R1680:Ints7 UTSW 1 191621162 splice site probably null
R1781:Ints7 UTSW 1 191596284 missense possibly damaging 0.95
R2141:Ints7 UTSW 1 191604860 missense possibly damaging 0.73
R2291:Ints7 UTSW 1 191606203 synonymous probably null
R4718:Ints7 UTSW 1 191583277 missense possibly damaging 0.60
R4741:Ints7 UTSW 1 191619635 missense probably benign 0.29
R4797:Ints7 UTSW 1 191596933 missense probably damaging 1.00
R4812:Ints7 UTSW 1 191594430 missense possibly damaging 0.73
R4826:Ints7 UTSW 1 191611906 missense probably damaging 0.97
R4870:Ints7 UTSW 1 191596331 missense probably damaging 0.97
R5169:Ints7 UTSW 1 191613090 missense probably benign 0.00
R5281:Ints7 UTSW 1 191615771 missense possibly damaging 0.90
R5694:Ints7 UTSW 1 191586618 missense probably damaging 1.00
R5752:Ints7 UTSW 1 191575893 missense probably benign 0.00
R6048:Ints7 UTSW 1 191621412 utr 3 prime probably benign
R6341:Ints7 UTSW 1 191613127 missense probably damaging 1.00
R6419:Ints7 UTSW 1 191602302 missense possibly damaging 0.69
R7037:Ints7 UTSW 1 191619605 missense probably benign 0.16
R7163:Ints7 UTSW 1 191617837 missense possibly damaging 0.67
R7603:Ints7 UTSW 1 191596224 missense probably damaging 1.00
R7801:Ints7 UTSW 1 191615747 missense possibly damaging 0.84
R7899:Ints7 UTSW 1 191621315 missense probably damaging 1.00
R8034:Ints7 UTSW 1 191613068 frame shift probably null
R8034:Ints7 UTSW 1 191613071 frame shift probably null
R8231:Ints7 UTSW 1 191596353 nonsense probably null
R8251:Ints7 UTSW 1 191621433 missense unknown
Z1177:Ints7 UTSW 1 191610458 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCCTCCTGTGCTCTGTGAGGAAG -3'
(R):5'- TCCGGCCAAACATTGAGAGTGAG -3'

Sequencing Primer
(F):5'- CTGTGCTCTGTGAGGAAGAGATAG -3'
(R):5'- AACCTTTCATCTTCAAGAATCTCTG -3'
Posted On2014-03-14