Incidental Mutation 'R1420:Iqcd'
ID160034
Institutional Source Beutler Lab
Gene Symbol Iqcd
Ensembl Gene ENSMUSG00000029601
Gene NameIQ motif containing D
Synonyms
MMRRC Submission 039476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1420 (G1)
Quality Score149
Status Not validated
Chromosome5
Chromosomal Location120589016-120607118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120600795 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 226 (L226P)
Ref Sequence ENSEMBL: ENSMUSP00000091955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069259] [ENSMUST00000094391] [ENSMUST00000111884] [ENSMUST00000156356]
Predicted Effect probably damaging
Transcript: ENSMUST00000069259
AA Change: L226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069167
Gene: ENSMUSG00000029601
AA Change: L226P

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 298 348 N/A INTRINSIC
IQ 363 385 5.53e-4 SMART
low complexity region 387 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094391
AA Change: L226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091955
Gene: ENSMUSG00000029601
AA Change: L226P

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 331 381 N/A INTRINSIC
IQ 396 418 5.53e-4 SMART
low complexity region 420 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147596
Predicted Effect probably benign
Transcript: ENSMUST00000156356
SMART Domains Protein: ENSMUSP00000122910
Gene: ENSMUSG00000029600

DomainStartEndE-ValueType
low complexity region 81 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,495,935 Y669H probably damaging Het
Amotl2 A T 9: 102,724,783 M409L possibly damaging Het
Ankrd35 A G 3: 96,684,738 E780G probably benign Het
Brwd1 T C 16: 96,036,034 Y866C probably damaging Het
Cul4b G C X: 38,565,041 probably null Het
Daw1 A T 1: 83,159,827 Y10F possibly damaging Het
Dgki A T 6: 37,050,269 probably null Het
Dnah3 A T 7: 119,951,979 V3039E probably damaging Het
Ercc4 C T 16: 13,130,209 T340I probably benign Het
Fam83b T C 9: 76,492,612 N403S possibly damaging Het
Fbxo18 A G 2: 11,767,682 F63L probably benign Het
Foxm1 G A 6: 128,372,921 R395H possibly damaging Het
Gtpbp4 C T 13: 8,973,262 A589T probably benign Het
Ifna7 C A 4: 88,816,669 H148N probably damaging Het
Il23r T C 6: 67,486,197 Y104C probably damaging Het
Il31ra A T 13: 112,531,752 W347R probably damaging Het
Ints7 T G 1: 191,613,057 F620V possibly damaging Het
Jak3 G T 8: 71,681,538 R428L possibly damaging Het
Kif28 C A 1: 179,702,397 C733F probably damaging Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Ksr2 A G 5: 117,414,839 E4G probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lrriq3 A G 3: 155,187,712 E350G probably benign Het
Nav3 G A 10: 109,823,254 A834V probably benign Het
Ncoa6 G A 2: 155,421,153 Q454* probably null Het
Nfatc2 C A 2: 168,504,665 M836I probably benign Het
Nphp3 G T 9: 104,035,893 probably null Het
Olfml2b C T 1: 170,669,027 T409M probably benign Het
Olfr955 A T 9: 39,469,993 H244Q probably damaging Het
Oprk1 A G 1: 5,602,321 K227R probably damaging Het
Pate1 A T 9: 35,685,209 W87R probably damaging Het
Pcnx4 T C 12: 72,555,986 Y341H probably benign Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pglyrp4 T C 3: 90,728,714 V82A probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Prdm9 C A 17: 15,544,376 C714F probably damaging Het
Pwp1 T C 10: 85,876,538 V80A probably damaging Het
Pxdn T C 12: 30,002,068 L568P probably damaging Het
Rasgrp4 C A 7: 29,140,345 Q161K probably damaging Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Slc16a6 A G 11: 109,454,946 V413A probably damaging Het
Slc7a15 T C 12: 8,534,442 T363A probably benign Het
Sufu T C 19: 46,397,184 S28P probably benign Het
Tex19.1 T C 11: 121,147,046 S77P probably damaging Het
Tmc7 A T 7: 118,566,217 Y91* probably null Het
Ttbk2 C G 2: 120,745,912 R792S probably benign Het
Tyw1 T C 5: 130,274,745 probably null Het
U2surp A G 9: 95,462,803 S907P probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vps50 T A 6: 3,588,007 L660* probably null Het
Wdr55 A G 18: 36,760,339 E18G probably benign Het
Wipi1 A G 11: 109,578,372 V331A probably benign Het
Other mutations in Iqcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Iqcd APN 5 120600489 missense probably benign 0.00
R1574:Iqcd UTSW 5 120600235 missense probably damaging 0.98
R1574:Iqcd UTSW 5 120600235 missense probably damaging 0.98
R4038:Iqcd UTSW 5 120602522 missense probably damaging 0.97
R4178:Iqcd UTSW 5 120602411 missense probably damaging 1.00
R4405:Iqcd UTSW 5 120602420 missense probably damaging 1.00
R5326:Iqcd UTSW 5 120602375 missense probably damaging 1.00
R5364:Iqcd UTSW 5 120600267 missense probably damaging 1.00
R5656:Iqcd UTSW 5 120605126 splice site probably null
R5691:Iqcd UTSW 5 120602506 nonsense probably null
R5711:Iqcd UTSW 5 120602506 nonsense probably null
R6387:Iqcd UTSW 5 120606855 missense probably benign 0.28
R6556:Iqcd UTSW 5 120602378 missense probably damaging 0.99
R6634:Iqcd UTSW 5 120600491 missense probably benign 0.14
R7067:Iqcd UTSW 5 120605147 missense probably damaging 1.00
R7672:Iqcd UTSW 5 120606816 missense probably damaging 1.00
R8207:Iqcd UTSW 5 120602449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCCGAGACTCCACCAAGACTG -3'
(R):5'- GTTGGGCTTTTCCTACAGACAGACC -3'

Sequencing Primer
(F):5'- AGTTCACCAGGCTGTTACAGG -3'
(R):5'- CATGAGAGAAGAGGCAAATCCCA -3'
Posted On2014-03-14