Incidental Mutation 'R1420:U2surp'
ID160056
Institutional Source Beutler Lab
Gene Symbol U2surp
Ensembl Gene ENSMUSG00000032407
Gene NameU2 snRNP-associated SURP domain containing
Synonyms2610101N10Rik
MMRRC Submission 039476-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R1420 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location95456898-95511996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95462803 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 907 (S907P)
Ref Sequence ENSEMBL: ENSMUSP00000077482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078374] [ENSMUST00000079659] [ENSMUST00000191213] [ENSMUST00000217176]
Predicted Effect probably benign
Transcript: ENSMUST00000078374
AA Change: S907P

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077482
Gene: ENSMUSG00000032407
AA Change: S907P

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
coiled coil region 148 186 N/A INTRINSIC
RRM 231 307 1.85e-18 SMART
low complexity region 313 323 N/A INTRINSIC
SWAP 384 438 1.07e-20 SMART
RPR 493 632 1.42e-41 SMART
internal_repeat_1 648 665 6.09e-7 PROSPERO
internal_repeat_1 678 698 6.09e-7 PROSPERO
coiled coil region 742 769 N/A INTRINSIC
cwf21 792 843 6.31e-17 SMART
low complexity region 881 933 N/A INTRINSIC
low complexity region 939 985 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000079659
AA Change: S951P
SMART Domains Protein: ENSMUSP00000078602
Gene: ENSMUSG00000032407
AA Change: S951P

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 1.85e-18 SMART
low complexity region 357 367 N/A INTRINSIC
SWAP 428 482 1.07e-20 SMART
RPR 537 676 1.42e-41 SMART
internal_repeat_1 692 709 1.14e-6 PROSPERO
internal_repeat_1 722 742 1.14e-6 PROSPERO
coiled coil region 786 813 N/A INTRINSIC
cwf21 836 887 6.31e-17 SMART
low complexity region 925 977 N/A INTRINSIC
low complexity region 983 1029 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191213
SMART Domains Protein: ENSMUSP00000140614
Gene: ENSMUSG00000032407

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 7.8e-21 SMART
low complexity region 357 367 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217176
AA Change: S950P
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,495,935 Y669H probably damaging Het
Amotl2 A T 9: 102,724,783 M409L possibly damaging Het
Ankrd35 A G 3: 96,684,738 E780G probably benign Het
Brwd1 T C 16: 96,036,034 Y866C probably damaging Het
Cul4b G C X: 38,565,041 probably null Het
Daw1 A T 1: 83,159,827 Y10F possibly damaging Het
Dgki A T 6: 37,050,269 probably null Het
Dnah3 A T 7: 119,951,979 V3039E probably damaging Het
Ercc4 C T 16: 13,130,209 T340I probably benign Het
Fam83b T C 9: 76,492,612 N403S possibly damaging Het
Fbxo18 A G 2: 11,767,682 F63L probably benign Het
Foxm1 G A 6: 128,372,921 R395H possibly damaging Het
Gtpbp4 C T 13: 8,973,262 A589T probably benign Het
Ifna7 C A 4: 88,816,669 H148N probably damaging Het
Il23r T C 6: 67,486,197 Y104C probably damaging Het
Il31ra A T 13: 112,531,752 W347R probably damaging Het
Ints7 T G 1: 191,613,057 F620V possibly damaging Het
Iqcd T C 5: 120,600,795 L226P probably damaging Het
Jak3 G T 8: 71,681,538 R428L possibly damaging Het
Kif28 C A 1: 179,702,397 C733F probably damaging Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Ksr2 A G 5: 117,414,839 E4G probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lrriq3 A G 3: 155,187,712 E350G probably benign Het
Nav3 G A 10: 109,823,254 A834V probably benign Het
Ncoa6 G A 2: 155,421,153 Q454* probably null Het
Nfatc2 C A 2: 168,504,665 M836I probably benign Het
Nphp3 G T 9: 104,035,893 probably null Het
Olfml2b C T 1: 170,669,027 T409M probably benign Het
Olfr955 A T 9: 39,469,993 H244Q probably damaging Het
Oprk1 A G 1: 5,602,321 K227R probably damaging Het
Pate1 A T 9: 35,685,209 W87R probably damaging Het
Pcnx4 T C 12: 72,555,986 Y341H probably benign Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pglyrp4 T C 3: 90,728,714 V82A probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Prdm9 C A 17: 15,544,376 C714F probably damaging Het
Pwp1 T C 10: 85,876,538 V80A probably damaging Het
Pxdn T C 12: 30,002,068 L568P probably damaging Het
Rasgrp4 C A 7: 29,140,345 Q161K probably damaging Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Slc16a6 A G 11: 109,454,946 V413A probably damaging Het
Slc7a15 T C 12: 8,534,442 T363A probably benign Het
Sufu T C 19: 46,397,184 S28P probably benign Het
Tex19.1 T C 11: 121,147,046 S77P probably damaging Het
Tmc7 A T 7: 118,566,217 Y91* probably null Het
Ttbk2 C G 2: 120,745,912 R792S probably benign Het
Tyw1 T C 5: 130,274,745 probably null Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vps50 T A 6: 3,588,007 L660* probably null Het
Wdr55 A G 18: 36,760,339 E18G probably benign Het
Wipi1 A G 11: 109,578,372 V331A probably benign Het
Other mutations in U2surp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:U2surp APN 9 95461524 utr 3 prime probably benign
IGL01122:U2surp APN 9 95490234 missense probably benign 0.02
IGL01985:U2surp APN 9 95490226 missense probably damaging 1.00
IGL01992:U2surp APN 9 95464419 missense possibly damaging 0.46
IGL01992:U2surp APN 9 95482181 missense probably damaging 0.99
IGL02300:U2surp APN 9 95488770 missense probably damaging 1.00
IGL02491:U2surp APN 9 95490220 missense probably damaging 0.98
IGL02503:U2surp APN 9 95502569 missense probably benign 0.03
IGL02615:U2surp APN 9 95493231 missense probably benign 0.00
IGL02628:U2surp APN 9 95472090 missense possibly damaging 0.89
IGL02682:U2surp APN 9 95481651 critical splice donor site probably null
IGL02721:U2surp APN 9 95474435 missense probably benign 0.10
IGL03200:U2surp APN 9 95491391 nonsense probably null
coup UTSW 9 95477512 missense probably damaging 1.00
R0095:U2surp UTSW 9 95500684 splice site probably null
R0373:U2surp UTSW 9 95484443 missense probably benign 0.08
R0376:U2surp UTSW 9 95484443 missense probably benign 0.08
R0377:U2surp UTSW 9 95484443 missense probably benign 0.08
R0416:U2surp UTSW 9 95485607 missense probably damaging 1.00
R0682:U2surp UTSW 9 95484443 missense probably benign 0.08
R0948:U2surp UTSW 9 95461497 utr 3 prime probably benign
R1474:U2surp UTSW 9 95493198 missense possibly damaging 0.49
R1555:U2surp UTSW 9 95466577 missense probably damaging 1.00
R1597:U2surp UTSW 9 95481740 splice site probably benign
R1638:U2surp UTSW 9 95484227 missense possibly damaging 0.95
R1693:U2surp UTSW 9 95511860 start codon destroyed probably null 0.53
R1851:U2surp UTSW 9 95482097 nonsense probably null
R2271:U2surp UTSW 9 95491420 missense possibly damaging 0.80
R2679:U2surp UTSW 9 95476232 missense possibly damaging 0.82
R2851:U2surp UTSW 9 95500682 splice site probably null
R3769:U2surp UTSW 9 95493697 splice site probably benign
R4596:U2surp UTSW 9 95485628 missense probably damaging 1.00
R4672:U2surp UTSW 9 95493145 missense possibly damaging 0.83
R4763:U2surp UTSW 9 95511791 intron probably benign
R4995:U2surp UTSW 9 95462794 utr 3 prime probably benign
R5805:U2surp UTSW 9 95479304 missense possibly damaging 0.51
R6006:U2surp UTSW 9 95479307 missense probably damaging 0.96
R6249:U2surp UTSW 9 95500816 missense probably benign 0.07
R6260:U2surp UTSW 9 95476157 missense probably damaging 0.99
R6378:U2surp UTSW 9 95491421 missense probably benign 0.41
R6487:U2surp UTSW 9 95477512 missense probably damaging 1.00
R6585:U2surp UTSW 9 95472071 missense probably damaging 1.00
R6721:U2surp UTSW 9 95491104 missense probably damaging 0.99
R6760:U2surp UTSW 9 95493711 missense probably benign 0.27
R7065:U2surp UTSW 9 95485659 missense probably benign 0.01
R7167:U2surp UTSW 9 95481673 missense probably damaging 0.98
R7219:U2surp UTSW 9 95490162 nonsense probably null
R7232:U2surp UTSW 9 95493717 missense probably benign 0.03
R7460:U2surp UTSW 9 95462824 missense unknown
R7547:U2surp UTSW 9 95479349 missense possibly damaging 0.94
R7609:U2surp UTSW 9 95485679 splice site probably null
R7761:U2surp UTSW 9 95488761 missense probably damaging 1.00
X0018:U2surp UTSW 9 95475288 missense probably benign 0.14
X0018:U2surp UTSW 9 95485597 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGAATCATGACAAACTGAGGGAGGAA -3'
(R):5'- AGTGGAGCTGGGAGACACTAGTAGTA -3'

Sequencing Primer
(F):5'- aaaaaaaaaaaaaaaaaGTGCCAAGC -3'
(R):5'- AGTAGTAAAATTAAACTGGGATGCC -3'
Posted On2014-03-14