Mutagenetix > Incidental Mutation

Incidental Mutation 'R1420:Aldh1l2'

160060

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

039476-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1420 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83495935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 669 (Y669H)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

probably damaging
Transcript: ENSMUST00000020497
AA Change: Y782H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: Y782H

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143793

Predicted Effect

probably damaging
Transcript: ENSMUST00000146640
AA Change: Y669H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: Y669H

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147381

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.6%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amotl2	A	T	9: 102,724,783	M409L	possibly damaging	Het
Ankrd35	A	G	3: 96,684,738	E780G	probably benign	Het
Brwd1	T	C	16: 96,036,034	Y866C	probably damaging	Het
Cul4b	G	C	X: 38,565,041		probably null	Het
Daw1	A	T	1: 83,159,827	Y10F	possibly damaging	Het
Dgki	A	T	6: 37,050,269		probably null	Het
Dnah3	A	T	7: 119,951,979	V3039E	probably damaging	Het
Ercc4	C	T	16: 13,130,209	T340I	probably benign	Het
Fam83b	T	C	9: 76,492,612	N403S	possibly damaging	Het
Fbxo18	A	G	2: 11,767,682	F63L	probably benign	Het
Foxm1	G	A	6: 128,372,921	R395H	possibly damaging	Het
Gtpbp4	C	T	13: 8,973,262	A589T	probably benign	Het
Ifna7	C	A	4: 88,816,669	H148N	probably damaging	Het
Il23r	T	C	6: 67,486,197	Y104C	probably damaging	Het
Il31ra	A	T	13: 112,531,752	W347R	probably damaging	Het
Ints7	T	G	1: 191,613,057	F620V	possibly damaging	Het
Iqcd	T	C	5: 120,600,795	L226P	probably damaging	Het
Jak3	G	T	8: 71,681,538	R428L	possibly damaging	Het
Kif28	C	A	1: 179,702,397	C733F	probably damaging	Het
Klkb1	C	A	8: 45,276,146	C347F	probably damaging	Het
Ksr2	A	G	5: 117,414,839	E4G	probably benign	Het
Lama1	T	C	17: 67,790,947	L1774P	probably damaging	Het
Lrriq3	A	G	3: 155,187,712	E350G	probably benign	Het
Nav3	G	A	10: 109,823,254	A834V	probably benign	Het
Ncoa6	G	A	2: 155,421,153	Q454*	probably null	Het
Nfatc2	C	A	2: 168,504,665	M836I	probably benign	Het
Nphp3	G	T	9: 104,035,893		probably null	Het
Olfml2b	C	T	1: 170,669,027	T409M	probably benign	Het
Olfr955	A	T	9: 39,469,993	H244Q	probably damaging	Het
Oprk1	A	G	1: 5,602,321	K227R	probably damaging	Het
Pate1	A	T	9: 35,685,209	W87R	probably damaging	Het
Pcnx4	T	C	12: 72,555,986	Y341H	probably benign	Het
Pde4c	T	A	8: 70,748,417	H421Q	probably damaging	Het
Pglyrp4	T	C	3: 90,728,714	V82A	probably damaging	Het
Pnmt	G	T	11: 98,387,676	R156L	probably benign	Het
Prdm9	C	A	17: 15,544,376	C714F	probably damaging	Het
Pwp1	T	C	10: 85,876,538	V80A	probably damaging	Het
Pxdn	T	C	12: 30,002,068	L568P	probably damaging	Het
Rasgrp4	C	A	7: 29,140,345	Q161K	probably damaging	Het
Rnf138	A	G	18: 21,026,102	E193G	probably damaging	Het
Slc16a6	A	G	11: 109,454,946	V413A	probably damaging	Het
Slc7a15	T	C	12: 8,534,442	T363A	probably benign	Het
Sufu	T	C	19: 46,397,184	S28P	probably benign	Het
Tex19.1	T	C	11: 121,147,046	S77P	probably damaging	Het
Tmc7	A	T	7: 118,566,217	Y91*	probably null	Het
Ttbk2	C	G	2: 120,745,912	R792S	probably benign	Het
Tyw1	T	C	5: 130,274,745		probably null	Het
U2surp	A	G	9: 95,462,803	S907P	probably benign	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988		probably benign	Het
Vps50	T	A	6: 3,588,007	L660*	probably null	Het
Wdr55	A	G	18: 36,760,339	E18G	probably benign	Het
Wipi1	A	G	11: 109,578,372	V331A	probably benign	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAAACAGAAGGGGCTGCCATCCA -3'
(R):5'- GCTATCCCCTAAGACTCTCCGAAAGAA -3'

Sequencing Primer
(F):5'- GGCTGCCATCCATTCCAG -3'
(R):5'- tccaggacagccagagag -3'

Posted On

2014-03-14