Incidental Mutation 'R1420:Brwd1'
ID160074
Institutional Source Beutler Lab
Gene Symbol Brwd1
Ensembl Gene ENSMUSG00000022914
Gene Namebromodomain and WD repeat domain containing 1
SynonymsG1-403-16, repro5, D530019K20Rik, 5330419I02Rik, Wdr9
MMRRC Submission 039476-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1420 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location95992092-96082428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96036034 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 866 (Y866C)
Ref Sequence ENSEMBL: ENSMUSP00000097101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000124370] [ENSMUST00000131322] [ENSMUST00000153398]
Predicted Effect probably damaging
Transcript: ENSMUST00000023631
AA Change: Y866C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: Y866C

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099502
AA Change: Y866C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: Y866C

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113829
AA Change: Y866C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: Y866C

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.13e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.13e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2177 2188 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124370
AA Change: Y545C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118423
Gene: ENSMUSG00000022914
AA Change: Y545C

DomainStartEndE-ValueType
WD40 34 75 3.82e1 SMART
WD40 80 119 4.27e-8 SMART
WD40 140 177 8.59e-1 SMART
WD40 180 220 1.47e-6 SMART
WD40 227 267 9.21e0 SMART
low complexity region 383 399 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 585 602 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131322
AA Change: Y313C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118327
Gene: ENSMUSG00000022914
AA Change: Y313C

DomainStartEndE-ValueType
low complexity region 107 123 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
Blast:BROMO 496 582 4e-37 BLAST
Blast:BROMO 603 627 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148432
Predicted Effect probably damaging
Transcript: ENSMUST00000153398
AA Change: Y866C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: Y866C

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
internal_repeat_1 1491 1957 1.45e-251 PROSPERO
internal_repeat_1 1956 2422 1.45e-251 PROSPERO
low complexity region 2630 2639 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184285
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,495,935 Y669H probably damaging Het
Amotl2 A T 9: 102,724,783 M409L possibly damaging Het
Ankrd35 A G 3: 96,684,738 E780G probably benign Het
Cul4b G C X: 38,565,041 probably null Het
Daw1 A T 1: 83,159,827 Y10F possibly damaging Het
Dgki A T 6: 37,050,269 probably null Het
Dnah3 A T 7: 119,951,979 V3039E probably damaging Het
Ercc4 C T 16: 13,130,209 T340I probably benign Het
Fam83b T C 9: 76,492,612 N403S possibly damaging Het
Fbxo18 A G 2: 11,767,682 F63L probably benign Het
Foxm1 G A 6: 128,372,921 R395H possibly damaging Het
Gtpbp4 C T 13: 8,973,262 A589T probably benign Het
Ifna7 C A 4: 88,816,669 H148N probably damaging Het
Il23r T C 6: 67,486,197 Y104C probably damaging Het
Il31ra A T 13: 112,531,752 W347R probably damaging Het
Ints7 T G 1: 191,613,057 F620V possibly damaging Het
Iqcd T C 5: 120,600,795 L226P probably damaging Het
Jak3 G T 8: 71,681,538 R428L possibly damaging Het
Kif28 C A 1: 179,702,397 C733F probably damaging Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Ksr2 A G 5: 117,414,839 E4G probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lrriq3 A G 3: 155,187,712 E350G probably benign Het
Nav3 G A 10: 109,823,254 A834V probably benign Het
Ncoa6 G A 2: 155,421,153 Q454* probably null Het
Nfatc2 C A 2: 168,504,665 M836I probably benign Het
Nphp3 G T 9: 104,035,893 probably null Het
Olfml2b C T 1: 170,669,027 T409M probably benign Het
Olfr955 A T 9: 39,469,993 H244Q probably damaging Het
Oprk1 A G 1: 5,602,321 K227R probably damaging Het
Pate1 A T 9: 35,685,209 W87R probably damaging Het
Pcnx4 T C 12: 72,555,986 Y341H probably benign Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pglyrp4 T C 3: 90,728,714 V82A probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Prdm9 C A 17: 15,544,376 C714F probably damaging Het
Pwp1 T C 10: 85,876,538 V80A probably damaging Het
Pxdn T C 12: 30,002,068 L568P probably damaging Het
Rasgrp4 C A 7: 29,140,345 Q161K probably damaging Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Slc16a6 A G 11: 109,454,946 V413A probably damaging Het
Slc7a15 T C 12: 8,534,442 T363A probably benign Het
Sufu T C 19: 46,397,184 S28P probably benign Het
Tex19.1 T C 11: 121,147,046 S77P probably damaging Het
Tmc7 A T 7: 118,566,217 Y91* probably null Het
Ttbk2 C G 2: 120,745,912 R792S probably benign Het
Tyw1 T C 5: 130,274,745 probably null Het
U2surp A G 9: 95,462,803 S907P probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vps50 T A 6: 3,588,007 L660* probably null Het
Wdr55 A G 18: 36,760,339 E18G probably benign Het
Wipi1 A G 11: 109,578,372 V331A probably benign Het
Other mutations in Brwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Brwd1 APN 16 96017586 missense probably damaging 1.00
IGL00974:Brwd1 APN 16 96043026 missense probably damaging 1.00
IGL01014:Brwd1 APN 16 96016173 missense probably benign 0.04
IGL01447:Brwd1 APN 16 96047379 nonsense probably null
IGL01459:Brwd1 APN 16 96047420 missense probably damaging 1.00
IGL01631:Brwd1 APN 16 96046466 missense probably damaging 1.00
IGL02184:Brwd1 APN 16 96013829 missense probably damaging 1.00
IGL02264:Brwd1 APN 16 96019456 missense probably damaging 0.98
IGL02679:Brwd1 APN 16 96002823 missense probably benign
IGL02833:Brwd1 APN 16 96052571 missense probably damaging 1.00
IGL02960:Brwd1 APN 16 96057466 missense probably damaging 1.00
IGL03053:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03074:Brwd1 APN 16 96011850 missense probably benign 0.00
IGL03135:Brwd1 APN 16 96021258 missense probably damaging 0.99
IGL03168:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03214:Brwd1 APN 16 96037900 missense probably benign 0.26
IGL03328:Brwd1 APN 16 96002725 missense probably damaging 0.99
bromide UTSW 16 96064887 missense probably damaging 1.00
Embers UTSW 16 96017604 missense probably damaging 1.00
Glowing UTSW 16 96035959 missense probably damaging 1.00
Soporific UTSW 16 96033843 nonsense probably null
PIT4243001:Brwd1 UTSW 16 96002671 nonsense probably null
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0030:Brwd1 UTSW 16 96021256 missense probably damaging 1.00
R0135:Brwd1 UTSW 16 96047104 missense probably damaging 1.00
R0366:Brwd1 UTSW 16 96037964 nonsense probably null
R0551:Brwd1 UTSW 16 96035974 missense probably damaging 1.00
R0586:Brwd1 UTSW 16 96043086 missense probably damaging 1.00
R0865:Brwd1 UTSW 16 96068584 missense probably damaging 1.00
R1226:Brwd1 UTSW 16 96031548 missense probably benign 0.35
R1329:Brwd1 UTSW 16 96003234 missense probably benign 0.07
R1378:Brwd1 UTSW 16 96041370 missense probably benign 0.06
R1441:Brwd1 UTSW 16 96066151 missense probably damaging 0.99
R1484:Brwd1 UTSW 16 96028291 splice site probably null
R1624:Brwd1 UTSW 16 96008144 missense possibly damaging 0.67
R1636:Brwd1 UTSW 16 96059641 missense probably damaging 1.00
R1988:Brwd1 UTSW 16 96021237 missense probably damaging 0.96
R1998:Brwd1 UTSW 16 96021288 missense probably damaging 1.00
R2066:Brwd1 UTSW 16 96046465 missense probably benign 0.01
R2898:Brwd1 UTSW 16 96066100 missense probably damaging 0.99
R2983:Brwd1 UTSW 16 96066574 missense probably damaging 0.98
R3966:Brwd1 UTSW 16 96044530 missense probably damaging 1.00
R4086:Brwd1 UTSW 16 96046372 missense probably benign 0.03
R4257:Brwd1 UTSW 16 96023496 missense probably damaging 1.00
R4290:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4292:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4293:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4614:Brwd1 UTSW 16 96047359 missense probably damaging 1.00
R4771:Brwd1 UTSW 16 96003318 missense probably benign 0.00
R5025:Brwd1 UTSW 16 96053972 missense probably damaging 0.97
R5155:Brwd1 UTSW 16 96002793 nonsense probably null
R5229:Brwd1 UTSW 16 96002209 missense possibly damaging 0.87
R5246:Brwd1 UTSW 16 96002557 missense probably damaging 1.00
R5668:Brwd1 UTSW 16 96016150 missense probably damaging 1.00
R5763:Brwd1 UTSW 16 96033843 nonsense probably null
R5782:Brwd1 UTSW 16 96043043 nonsense probably null
R5831:Brwd1 UTSW 16 96019436 missense probably damaging 1.00
R5836:Brwd1 UTSW 16 96064758 missense probably damaging 1.00
R5906:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
R5995:Brwd1 UTSW 16 96064787 missense probably damaging 1.00
R6143:Brwd1 UTSW 16 96002956 missense probably benign 0.00
R6241:Brwd1 UTSW 16 96013874 missense probably damaging 1.00
R6313:Brwd1 UTSW 16 96007941 missense probably benign 0.01
R6362:Brwd1 UTSW 16 96002307 missense probably damaging 1.00
R6551:Brwd1 UTSW 16 95993962 missense possibly damaging 0.55
R6736:Brwd1 UTSW 16 96068572 missense probably damaging 1.00
R6822:Brwd1 UTSW 16 96041274 missense probably benign 0.42
R7080:Brwd1 UTSW 16 96009530 missense probably benign 0.01
R7131:Brwd1 UTSW 16 96066498 missense probably damaging 1.00
R7208:Brwd1 UTSW 16 96035959 missense probably damaging 1.00
R7322:Brwd1 UTSW 16 96066119 missense probably damaging 1.00
R7483:Brwd1 UTSW 16 96056173 missense probably damaging 0.99
R7615:Brwd1 UTSW 16 96033839 missense probably damaging 0.96
R7621:Brwd1 UTSW 16 96064887 missense probably damaging 1.00
R7665:Brwd1 UTSW 16 96041343 missense probably benign 0.09
R7697:Brwd1 UTSW 16 96046401 missense probably benign 0.10
R7740:Brwd1 UTSW 16 96027368 missense probably damaging 1.00
R8120:Brwd1 UTSW 16 96019449 missense probably benign 0.23
R8187:Brwd1 UTSW 16 96002734 missense probably damaging 0.98
R8359:Brwd1 UTSW 16 96016209 missense probably damaging 1.00
R8511:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
X0017:Brwd1 UTSW 16 96044491 missense probably damaging 1.00
X0028:Brwd1 UTSW 16 96011923 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CGAAATGCAAGCATACATATGCACATGA -3'
(R):5'- ACCTTCTTTCCAGTGATGGTGAAGAGT -3'

Sequencing Primer
(F):5'- gaaagaaagaaggaaggaaggaag -3'
(R):5'- tgcccaaagccagaagac -3'
Posted On2014-03-14