Incidental Mutation 'R1401:Adam33'
ID160094
Institutional Source Beutler Lab
Gene Symbol Adam33
Ensembl Gene ENSMUSG00000027318
Gene Namea disintegrin and metallopeptidase domain 33
Synonyms
MMRRC Submission 039463-MU
Accession Numbers

Genbank: NM_033615, NM_001163529; MGI: 1341813

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1401 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131050591-131063814 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 131051471 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000052104] [ENSMUST00000110232] [ENSMUST00000183552]
Predicted Effect probably benign
Transcript: ENSMUST00000052104
SMART Domains Protein: ENSMUSP00000052486
Gene: ENSMUSG00000027318

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 1.9e-28 PFAM
Pfam:Reprolysin_5 209 390 6.9e-21 PFAM
Pfam:Reprolysin_4 209 401 3.5e-9 PFAM
Pfam:Reprolysin 211 410 1.9e-60 PFAM
Pfam:Reprolysin_2 232 400 3e-14 PFAM
Pfam:Reprolysin_3 235 357 1.2e-16 PFAM
DISIN 427 502 8.4e-42 SMART
ACR 503 647 6.8e-51 SMART
transmembrane domain 677 699 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110232
SMART Domains Protein: ENSMUSP00000105861
Gene: ENSMUSG00000027318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 168 1.3e-24 PFAM
Pfam:Reprolysin_5 209 390 8.5e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 4e-63 PFAM
Pfam:Reprolysin_2 231 400 7.3e-17 PFAM
Pfam:Reprolysin_3 235 357 2.2e-20 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134742
Predicted Effect probably benign
Transcript: ENSMUST00000135149
SMART Domains Protein: ENSMUSP00000122608
Gene: ENSMUSG00000027318

DomainStartEndE-ValueType
Pfam:Reprolysin_5 68 249 1.8e-23 PFAM
Pfam:Reprolysin_4 68 260 8.6e-12 PFAM
Pfam:Reprolysin 70 269 8.3e-64 PFAM
Pfam:Reprolysin_2 90 259 1.5e-17 PFAM
Pfam:Reprolysin_3 94 216 5.1e-21 PFAM
DISIN 286 361 1.66e-39 SMART
ACR 362 505 8.02e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149625
Predicted Effect probably benign
Transcript: ENSMUST00000183552
SMART Domains Protein: ENSMUSP00000139344
Gene: ENSMUSG00000027318

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 2.4e-30 PFAM
Pfam:Reprolysin_5 209 390 8.2e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 2.4e-62 PFAM
Pfam:Reprolysin_2 232 400 2.8e-16 PFAM
Pfam:Reprolysin_3 235 357 1.5e-18 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184921
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is widely expressed, most highly in the adult brain, heart, kidney, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted gene deletion are viable, fertile, developmentally normal and display normal allergen-induced airway hyperreactivity, IgE production, mucus metaplasia, and airway inflammation in an OVA-induced model of allergic asthma. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abcg1 T A 17: 31,114,158 I625N possibly damaging Het
Adgrl2 A T 3: 148,822,981 I1185N probably damaging Het
Afp A T 5: 90,501,627 probably benign Het
Aggf1 A G 13: 95,364,848 V342A probably benign Het
Ankrd11 A T 8: 122,893,050 S1333R probably benign Het
Arhgef11 C A 3: 87,733,469 S1311* probably null Het
Atp6v1g1 T C 4: 63,548,641 Y47H probably benign Het
Atp8b4 T C 2: 126,323,093 probably null Het
Barx2 A G 9: 31,859,031 L67P probably damaging Het
Bbs7 G A 3: 36,573,557 P694S probably benign Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
C2 T C 17: 34,872,481 T69A possibly damaging Het
C8b T G 4: 104,784,482 L205R possibly damaging Het
Cct4 T G 11: 22,994,333 N72K probably damaging Het
Cd300lg C A 11: 102,054,155 P353H possibly damaging Het
Cdh20 A T 1: 104,947,497 I335L possibly damaging Het
Cfhr2 T A 1: 139,811,019 H268L probably benign Het
Chia1 T A 3: 106,128,939 D278E probably benign Het
Cntn6 A G 6: 104,804,398 T482A possibly damaging Het
Cst13 T A 2: 148,823,096 F4I probably benign Het
Ctsc T A 7: 88,281,498 V95E probably damaging Het
Ddhd1 A T 14: 45,605,051 probably null Het
Dmxl2 A T 9: 54,415,428 probably null Het
Dnah5 A C 15: 28,401,913 T3407P probably damaging Het
Dock1 T A 7: 135,133,936 Y1344* probably null Het
Eif4g3 T C 4: 138,206,084 V1740A probably damaging Het
Epb41l5 A G 1: 119,578,904 probably benign Het
Fam159b A T 13: 104,863,605 C37S probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Gm12790 A G 4: 101,968,199 L6P probably benign Het
Gramd4 A G 15: 86,125,196 D210G probably damaging Het
Hectd3 T C 4: 117,002,269 S697P possibly damaging Het
Hsf4 T C 8: 105,275,603 V399A probably benign Het
Hyal6 T A 6: 24,743,435 C377S probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Mypn A G 10: 63,152,857 V463A probably damaging Het
Nav1 T A 1: 135,460,425 I1144L probably benign Het
Nckap5 A G 1: 126,014,661 probably benign Het
Nipbl A T 15: 8,372,173 S30T probably damaging Het
Nmt1 T C 11: 103,057,481 F277S probably damaging Het
Nploc4 A C 11: 120,383,289 probably benign Het
Nup54 C A 5: 92,428,221 R137I probably damaging Het
Olfr667 T C 7: 104,916,756 Y180C probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pkd1l1 G T 11: 8,854,487 Y1701* probably null Het
Plekhg6 T C 6: 125,363,109 T763A probably damaging Het
Pmepa1 C T 2: 173,228,575 probably null Het
Ppfia2 A G 10: 106,830,657 E408G possibly damaging Het
Pramef12 G A 4: 144,395,088 T122M probably benign Het
Prl8a2 G A 13: 27,353,996 V218I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
RP23-114B10.6 T C 8: 69,373,370 noncoding transcript Het
Slc13a1 A T 6: 24,118,083 probably null Het
Slc17a8 T A 10: 89,591,214 T342S probably damaging Het
Slc30a9 A G 5: 67,352,662 E519G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc39a5 G A 10: 128,397,741 L296F probably damaging Het
Slco6b1 A C 1: 96,929,885 noncoding transcript Het
Slco6d1 G A 1: 98,490,616 G509D probably damaging Het
Spen A G 4: 141,471,821 V3142A probably damaging Het
Spta1 T A 1: 174,222,684 H1763Q probably damaging Het
Srcap T C 7: 127,559,952 probably benign Het
Stard9 T C 2: 120,712,847 probably benign Het
Stat4 A G 1: 52,071,947 probably benign Het
Svbp T A 4: 119,196,028 probably benign Het
Tm2d1 A T 4: 98,370,596 probably benign Het
Trpv1 C A 11: 73,240,126 probably null Het
Trrap A G 5: 144,857,422 D3713G possibly damaging Het
Ubr1 T A 2: 120,955,644 D165V probably benign Het
Utrn C A 10: 12,649,153 M2195I probably benign Het
Vmn1r229 G A 17: 20,814,642 V50I possibly damaging Het
Vmn1r44 A T 6: 89,893,650 H126L probably benign Het
Vmn2r116 T C 17: 23,386,596 probably benign Het
Vmn2r27 A C 6: 124,191,632 Y846* probably null Het
Vmn2r84 T A 10: 130,391,990 S126C possibly damaging Het
Xylb T A 9: 119,368,067 probably benign Het
Zfp282 A T 6: 47,890,174 K232* probably null Het
Zfp39 C A 11: 58,890,323 V538L probably benign Het
Zfp560 T C 9: 20,351,853 N76D possibly damaging Het
Zmym4 C T 4: 126,911,169 V433I probably benign Het
Zscan5b A G 7: 6,230,426 E83G probably damaging Het
Other mutations in Adam33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adam33 APN 2 131054263 splice site probably benign
IGL01586:Adam33 APN 2 131054050 missense probably damaging 1.00
IGL02156:Adam33 APN 2 131053158 splice site probably benign
IGL02498:Adam33 APN 2 131053237 missense probably damaging 1.00
3-1:Adam33 UTSW 2 131054121 splice site probably null
R0012:Adam33 UTSW 2 131052920 missense probably damaging 1.00
R0471:Adam33 UTSW 2 131054479 missense probably damaging 0.99
R2071:Adam33 UTSW 2 131055346 missense probably benign 0.01
R2095:Adam33 UTSW 2 131053709 missense probably damaging 1.00
R2383:Adam33 UTSW 2 131051362 missense probably benign 0.01
R4077:Adam33 UTSW 2 131063524 utr 5 prime probably benign
R4403:Adam33 UTSW 2 131053270 missense probably benign 0.03
R4821:Adam33 UTSW 2 131061195 missense probably benign 0.03
R5110:Adam33 UTSW 2 131053770 missense probably damaging 1.00
R5150:Adam33 UTSW 2 131053197 intron probably benign
R5364:Adam33 UTSW 2 131054472 critical splice donor site probably null
R5632:Adam33 UTSW 2 131053442 missense probably damaging 1.00
R5818:Adam33 UTSW 2 131054358 missense possibly damaging 0.51
R6226:Adam33 UTSW 2 131055610 missense probably damaging 1.00
R6478:Adam33 UTSW 2 131051346 missense probably benign 0.01
R6755:Adam33 UTSW 2 131053149 missense probably damaging 1.00
R7230:Adam33 UTSW 2 131053563 missense probably damaging 1.00
R7322:Adam33 UTSW 2 131053694 missense probably damaging 1.00
R7395:Adam33 UTSW 2 131061169 missense probably benign 0.00
R7650:Adam33 UTSW 2 131061147 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTAAGCTCAGAGTTCGCAGGG -3'
(R):5'- TAGACTGGCAGAGCACGGCTAAAC -3'

Sequencing Primer
(F):5'- CAGAGTTCGCAGGGTCTGAG -3'
(R):5'- GTGACGCCTACATCTAGACTGAG -3'
Posted On2014-03-14