Incidental Mutation 'R1401:Zmym4'
ID 160109
Institutional Source Beutler Lab
Gene Symbol Zmym4
Ensembl Gene ENSMUSG00000042446
Gene Name zinc finger, MYM-type 4
Synonyms Zfp262, 6330503C17Rik
MMRRC Submission 039463-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock # R1401 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126861939-126968135 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 126911169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 433 (V433I)
Ref Sequence ENSEMBL: ENSMUSP00000101714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106108]
AlphaFold A2A791
Predicted Effect probably benign
Transcript: ENSMUST00000106108
AA Change: V433I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101714
Gene: ENSMUSG00000042446
AA Change: V433I

DomainStartEndE-ValueType
TRASH 341 377 6.53e-4 SMART
TRASH 389 429 7.22e-6 SMART
TRASH 441 479 1.77e0 SMART
TRASH 486 525 4.95e-4 SMART
TRASH 531 569 1.05e-2 SMART
TRASH 579 615 2.82e1 SMART
low complexity region 640 649 N/A INTRINSIC
TRASH 687 723 8.49e-3 SMART
TRASH 729 764 1.14e-3 SMART
TRASH 772 810 4.48e-2 SMART
TRASH 816 851 2.06e-1 SMART
low complexity region 974 993 N/A INTRINSIC
low complexity region 1002 1021 N/A INTRINSIC
Pfam:DUF3504 1357 1527 1.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135003
AA Change: V181I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120813
Gene: ENSMUSG00000042446
AA Change: V181I

DomainStartEndE-ValueType
TRASH 90 126 6.53e-4 SMART
TRASH 138 178 7.22e-6 SMART
TRASH 190 228 1.77e0 SMART
TRASH 235 274 3.05e-4 SMART
low complexity region 300 309 N/A INTRINSIC
TRASH 347 383 8.49e-3 SMART
TRASH 389 424 1.14e-3 SMART
TRASH 432 470 4.48e-2 SMART
TRASH 476 511 2.06e-1 SMART
low complexity region 634 653 N/A INTRINSIC
low complexity region 662 681 N/A INTRINSIC
Pfam:DUF3504 1017 1187 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152952
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 98% (87/89)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abcg1 T A 17: 31,114,158 I625N possibly damaging Het
Adam33 C A 2: 131,051,471 probably benign Het
Adgrl2 A T 3: 148,822,981 I1185N probably damaging Het
Afp A T 5: 90,501,627 probably benign Het
Aggf1 A G 13: 95,364,848 V342A probably benign Het
Ankrd11 A T 8: 122,893,050 S1333R probably benign Het
Arhgef11 C A 3: 87,733,469 S1311* probably null Het
Atp6v1g1 T C 4: 63,548,641 Y47H probably benign Het
Atp8b4 T C 2: 126,323,093 probably null Het
Barx2 A G 9: 31,859,031 L67P probably damaging Het
Bbs7 G A 3: 36,573,557 P694S probably benign Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
C2 T C 17: 34,872,481 T69A possibly damaging Het
C8b T G 4: 104,784,482 L205R possibly damaging Het
Cct4 T G 11: 22,994,333 N72K probably damaging Het
Cd300lg C A 11: 102,054,155 P353H possibly damaging Het
Cdh20 A T 1: 104,947,497 I335L possibly damaging Het
Cfhr2 T A 1: 139,811,019 H268L probably benign Het
Chia1 T A 3: 106,128,939 D278E probably benign Het
Cntn6 A G 6: 104,804,398 T482A possibly damaging Het
Cst13 T A 2: 148,823,096 F4I probably benign Het
Ctsc T A 7: 88,281,498 V95E probably damaging Het
Ddhd1 A T 14: 45,605,051 probably null Het
Dmxl2 A T 9: 54,415,428 probably null Het
Dnah5 A C 15: 28,401,913 T3407P probably damaging Het
Dock1 T A 7: 135,133,936 Y1344* probably null Het
Eif4g3 T C 4: 138,206,084 V1740A probably damaging Het
Epb41l5 A G 1: 119,578,904 probably benign Het
Fam159b A T 13: 104,863,605 C37S probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Gm12790 A G 4: 101,968,199 L6P probably benign Het
Gramd4 A G 15: 86,125,196 D210G probably damaging Het
Hectd3 T C 4: 117,002,269 S697P possibly damaging Het
Hsf4 T C 8: 105,275,603 V399A probably benign Het
Hyal6 T A 6: 24,743,435 C377S probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Mypn A G 10: 63,152,857 V463A probably damaging Het
Nav1 T A 1: 135,460,425 I1144L probably benign Het
Nckap5 A G 1: 126,014,661 probably benign Het
Nipbl A T 15: 8,372,173 S30T probably damaging Het
Nmt1 T C 11: 103,057,481 F277S probably damaging Het
Nploc4 A C 11: 120,383,289 probably benign Het
Nup54 C A 5: 92,428,221 R137I probably damaging Het
Olfr667 T C 7: 104,916,756 Y180C probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pkd1l1 G T 11: 8,854,487 Y1701* probably null Het
Plekhg6 T C 6: 125,363,109 T763A probably damaging Het
Pmepa1 C T 2: 173,228,575 probably null Het
Ppfia2 A G 10: 106,830,657 E408G possibly damaging Het
Pramef12 G A 4: 144,395,088 T122M probably benign Het
Prl8a2 G A 13: 27,353,996 V218I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
RP23-114B10.6 T C 8: 69,373,370 noncoding transcript Het
Slc13a1 A T 6: 24,118,083 probably null Het
Slc17a8 T A 10: 89,591,214 T342S probably damaging Het
Slc30a9 A G 5: 67,352,662 E519G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc39a5 G A 10: 128,397,741 L296F probably damaging Het
Slco6b1 A C 1: 96,929,885 noncoding transcript Het
Slco6d1 G A 1: 98,490,616 G509D probably damaging Het
Spen A G 4: 141,471,821 V3142A probably damaging Het
Spta1 T A 1: 174,222,684 H1763Q probably damaging Het
Srcap T C 7: 127,559,952 probably benign Het
Stard9 T C 2: 120,712,847 probably benign Het
Stat4 A G 1: 52,071,947 probably benign Het
Svbp T A 4: 119,196,028 probably benign Het
Tm2d1 A T 4: 98,370,596 probably benign Het
Trpv1 C A 11: 73,240,126 probably null Het
Trrap A G 5: 144,857,422 D3713G possibly damaging Het
Ubr1 T A 2: 120,955,644 D165V probably benign Het
Utrn C A 10: 12,649,153 M2195I probably benign Het
Vmn1r229 G A 17: 20,814,642 V50I possibly damaging Het
Vmn1r44 A T 6: 89,893,650 H126L probably benign Het
Vmn2r116 T C 17: 23,386,596 probably benign Het
Vmn2r27 A C 6: 124,191,632 Y846* probably null Het
Vmn2r84 T A 10: 130,391,990 S126C possibly damaging Het
Xylb T A 9: 119,368,067 probably benign Het
Zfp282 A T 6: 47,890,174 K232* probably null Het
Zfp39 C A 11: 58,890,323 V538L probably benign Het
Zfp560 T C 9: 20,351,853 N76D possibly damaging Het
Zscan5b A G 7: 6,230,426 E83G probably damaging Het
Other mutations in Zmym4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zmym4 APN 4 126890058 missense probably benign
IGL00845:Zmym4 APN 4 126900613 missense probably benign 0.28
IGL01122:Zmym4 APN 4 126864252 missense probably damaging 1.00
IGL01374:Zmym4 APN 4 126868957 missense probably damaging 1.00
IGL01564:Zmym4 APN 4 126911280 missense possibly damaging 0.84
IGL02014:Zmym4 APN 4 126900669 missense possibly damaging 0.67
IGL02187:Zmym4 APN 4 126870273 missense probably damaging 0.97
IGL02887:Zmym4 APN 4 126948475 missense probably damaging 0.96
IGL03371:Zmym4 APN 4 126915088 missense possibly damaging 0.90
IGL03400:Zmym4 APN 4 126923127 missense probably benign 0.12
arriba UTSW 4 126915622 missense probably damaging 0.97
foreclosed UTSW 4 126895306 missense probably damaging 1.00
Foreshortened UTSW 4 126910936 missense possibly damaging 0.75
levantese UTSW 4 126864168 missense probably damaging 0.99
terminated UTSW 4 126925795 missense probably benign 0.02
BB004:Zmym4 UTSW 4 126905377 missense probably benign 0.42
BB014:Zmym4 UTSW 4 126905377 missense probably benign 0.42
R0149:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0361:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0423:Zmym4 UTSW 4 126882319 splice site probably benign
R0532:Zmym4 UTSW 4 126898401 nonsense probably null
R0745:Zmym4 UTSW 4 126902703 splice site probably benign
R1183:Zmym4 UTSW 4 126925839 missense probably damaging 0.99
R1446:Zmym4 UTSW 4 126882482 missense probably damaging 1.00
R1491:Zmym4 UTSW 4 126882312 critical splice acceptor site probably null
R1566:Zmym4 UTSW 4 126911147 missense possibly damaging 0.94
R1962:Zmym4 UTSW 4 126902670 missense possibly damaging 0.47
R2398:Zmym4 UTSW 4 126923136 missense probably damaging 1.00
R2930:Zmym4 UTSW 4 126925523 missense probably benign 0.00
R3891:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R3892:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R4659:Zmym4 UTSW 4 126948428 splice site probably null
R4702:Zmym4 UTSW 4 126923165 missense probably benign 0.01
R5160:Zmym4 UTSW 4 126870184 missense probably damaging 0.97
R5614:Zmym4 UTSW 4 126910936 missense possibly damaging 0.75
R5773:Zmym4 UTSW 4 126905370 missense possibly damaging 0.52
R6450:Zmym4 UTSW 4 126895306 missense probably damaging 1.00
R6741:Zmym4 UTSW 4 126915085 missense possibly damaging 0.80
R7023:Zmym4 UTSW 4 126868800 missense probably damaging 1.00
R7315:Zmym4 UTSW 4 126882592 missense probably benign 0.09
R7468:Zmym4 UTSW 4 126882236 missense probably benign 0.40
R7546:Zmym4 UTSW 4 126864168 missense probably damaging 0.99
R7609:Zmym4 UTSW 4 126925795 missense probably benign 0.02
R7764:Zmym4 UTSW 4 126925616 missense probably benign 0.06
R7897:Zmym4 UTSW 4 126889539 missense possibly damaging 0.76
R7918:Zmym4 UTSW 4 126911004 critical splice acceptor site probably null
R7927:Zmym4 UTSW 4 126905377 missense probably benign 0.42
R8129:Zmym4 UTSW 4 126915163 missense possibly damaging 0.87
R8240:Zmym4 UTSW 4 126904395 critical splice donor site probably null
R8248:Zmym4 UTSW 4 126905369 missense possibly damaging 0.56
R8261:Zmym4 UTSW 4 126904567 missense probably damaging 1.00
R8313:Zmym4 UTSW 4 126910969 missense probably benign 0.19
R8353:Zmym4 UTSW 4 126907112 missense possibly damaging 0.46
R8747:Zmym4 UTSW 4 126893405 missense probably damaging 1.00
R8787:Zmym4 UTSW 4 126923160 missense probably benign 0.41
R8795:Zmym4 UTSW 4 126906026 missense probably benign 0.35
R8948:Zmym4 UTSW 4 126864267 missense probably damaging 1.00
R9218:Zmym4 UTSW 4 126915622 missense probably damaging 0.97
R9233:Zmym4 UTSW 4 126882517 missense probably damaging 0.99
R9286:Zmym4 UTSW 4 126890019 missense probably damaging 1.00
R9468:Zmym4 UTSW 4 126907200 missense probably benign 0.01
R9542:Zmym4 UTSW 4 126905371 missense probably benign 0.00
R9756:Zmym4 UTSW 4 126877709 missense probably damaging 1.00
R9776:Zmym4 UTSW 4 126911149 missense possibly damaging 0.51
U24488:Zmym4 UTSW 4 126925660 missense possibly damaging 0.69
Z1177:Zmym4 UTSW 4 126907212 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGCCCCTCAATTTGCAGCAC -3'
(R):5'- tctcaccagccccCAAAATTACAAATG -3'

Sequencing Primer
(F):5'- ATTTGCAGCACATGGCACTG -3'
(R):5'- GTTCCTTTAATATACCAAGAGGGTGG -3'
Posted On 2014-03-14