Mutagenetix > Incidental Mutation

Incidental Mutation 'R1401:Cntn6'

160121

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

039463-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R1401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104804398 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 482 (T482A)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089215
AA Change: T482A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: T482A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161070
AA Change: T410A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: T410A

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162872
AA Change: T482A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: T482A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Meta Mutation Damage Score

0.0893

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.4%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abcg1	T	A	17: 31,114,158	I625N	possibly damaging	Het
Adam33	C	A	2: 131,051,471		probably benign	Het
Adgrl2	A	T	3: 148,822,981	I1185N	probably damaging	Het
Afp	A	T	5: 90,501,627		probably benign	Het
Aggf1	A	G	13: 95,364,848	V342A	probably benign	Het
Ankrd11	A	T	8: 122,893,050	S1333R	probably benign	Het
Arhgef11	C	A	3: 87,733,469	S1311*	probably null	Het
Atp6v1g1	T	C	4: 63,548,641	Y47H	probably benign	Het
Atp8b4	T	C	2: 126,323,093		probably null	Het
Barx2	A	G	9: 31,859,031	L67P	probably damaging	Het
Bbs7	G	A	3: 36,573,557	P694S	probably benign	Het
Btbd10	A	T	7: 113,347,059	V33E	probably benign	Het
C2	T	C	17: 34,872,481	T69A	possibly damaging	Het
C8b	T	G	4: 104,784,482	L205R	possibly damaging	Het
Cct4	T	G	11: 22,994,333	N72K	probably damaging	Het
Cd300lg	C	A	11: 102,054,155	P353H	possibly damaging	Het
Cdh20	A	T	1: 104,947,497	I335L	possibly damaging	Het
Cfhr2	T	A	1: 139,811,019	H268L	probably benign	Het
Chia1	T	A	3: 106,128,939	D278E	probably benign	Het
Cst13	T	A	2: 148,823,096	F4I	probably benign	Het
Ctsc	T	A	7: 88,281,498	V95E	probably damaging	Het
Ddhd1	A	T	14: 45,605,051		probably null	Het
Dmxl2	A	T	9: 54,415,428		probably null	Het
Dnah5	A	C	15: 28,401,913	T3407P	probably damaging	Het
Dock1	T	A	7: 135,133,936	Y1344*	probably null	Het
Eif4g3	T	C	4: 138,206,084	V1740A	probably damaging	Het
Epb41l5	A	G	1: 119,578,904		probably benign	Het
Fam159b	A	T	13: 104,863,605	C37S	probably damaging	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Gm12790	A	G	4: 101,968,199	L6P	probably benign	Het
Gramd4	A	G	15: 86,125,196	D210G	probably damaging	Het
Hectd3	T	C	4: 117,002,269	S697P	possibly damaging	Het
Hsf4	T	C	8: 105,275,603	V399A	probably benign	Het
Hyal6	T	A	6: 24,743,435	C377S	probably damaging	Het
Myb	C	T	10: 21,152,945	V85M	probably damaging	Het
Mypn	A	G	10: 63,152,857	V463A	probably damaging	Het
Nav1	T	A	1: 135,460,425	I1144L	probably benign	Het
Nckap5	A	G	1: 126,014,661		probably benign	Het
Nipbl	A	T	15: 8,372,173	S30T	probably damaging	Het
Nmt1	T	C	11: 103,057,481	F277S	probably damaging	Het
Nploc4	A	C	11: 120,383,289		probably benign	Het
Nup54	C	A	5: 92,428,221	R137I	probably damaging	Het
Olfr667	T	C	7: 104,916,756	Y180C	probably damaging	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pkd1l1	G	T	11: 8,854,487	Y1701*	probably null	Het
Plekhg6	T	C	6: 125,363,109	T763A	probably damaging	Het
Pmepa1	C	T	2: 173,228,575		probably null	Het
Ppfia2	A	G	10: 106,830,657	E408G	possibly damaging	Het
Pramef12	G	A	4: 144,395,088	T122M	probably benign	Het
Prl8a2	G	A	13: 27,353,996	V218I	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
RP23-114B10.6	T	C	8: 69,373,370		noncoding transcript	Het
Slc13a1	A	T	6: 24,118,083		probably null	Het
Slc17a8	T	A	10: 89,591,214	T342S	probably damaging	Het
Slc30a9	A	G	5: 67,352,662	E519G	probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc39a5	G	A	10: 128,397,741	L296F	probably damaging	Het
Slco6b1	A	C	1: 96,929,885		noncoding transcript	Het
Slco6d1	G	A	1: 98,490,616	G509D	probably damaging	Het
Spen	A	G	4: 141,471,821	V3142A	probably damaging	Het
Spta1	T	A	1: 174,222,684	H1763Q	probably damaging	Het
Srcap	T	C	7: 127,559,952		probably benign	Het
Stard9	T	C	2: 120,712,847		probably benign	Het
Stat4	A	G	1: 52,071,947		probably benign	Het
Svbp	T	A	4: 119,196,028		probably benign	Het
Tm2d1	A	T	4: 98,370,596		probably benign	Het
Trpv1	C	A	11: 73,240,126		probably null	Het
Trrap	A	G	5: 144,857,422	D3713G	possibly damaging	Het
Ubr1	T	A	2: 120,955,644	D165V	probably benign	Het
Utrn	C	A	10: 12,649,153	M2195I	probably benign	Het
Vmn1r229	G	A	17: 20,814,642	V50I	possibly damaging	Het
Vmn1r44	A	T	6: 89,893,650	H126L	probably benign	Het
Vmn2r116	T	C	17: 23,386,596		probably benign	Het
Vmn2r27	A	C	6: 124,191,632	Y846*	probably null	Het
Vmn2r84	T	A	10: 130,391,990	S126C	possibly damaging	Het
Xylb	T	A	9: 119,368,067		probably benign	Het
Zfp282	A	T	6: 47,890,174	K232*	probably null	Het
Zfp39	C	A	11: 58,890,323	V538L	probably benign	Het
Zfp560	T	C	9: 20,351,853	N76D	possibly damaging	Het
Zmym4	C	T	4: 126,911,169	V433I	probably benign	Het
Zscan5b	A	G	7: 6,230,426	E83G	probably damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACACAAACTCTTATGCCTTTTGTGCC -3'
(R):5'- TCACATTGACCGTAGCATCACATTCC -3'

Sequencing Primer
(F):5'- ATGCCTTTTGTGCCAATGTTTAG -3'
(R):5'- GTAGCATCACATTCCTAAATGGGAC -3'

Posted On

2014-03-14