Mutagenetix > Incidental Mutation

Incidental Mutation 'R1401:Dmxl2'

160139

Institutional Source

Beutler Lab

Gene Symbol

Dmxl2

Ensembl Gene

ENSMUSG00000041268

Gene Name

Dmx-like 2

Synonyms

E130119P06Rik, 6430411K14Rik

MMRRC Submission

039463-MU

Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54365158-54501626 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 54415428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600] [ENSMUST00000127880]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000118163

SMART Domains

Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268

Domain	Start	End	E-Value	Type
WD40	43	84	4.58e1	SMART
WD40	100	136	2.28e2	SMART
WD40	159	198	2.57e-2	SMART
WD40	221	269	1.03e-1	SMART
low complexity region	420	440	N/A	INTRINSIC
WD40	741	793	1.42e2	SMART
low complexity region	861	875	N/A	INTRINSIC
low complexity region	945	961	N/A	INTRINSIC
WD40	985	1029	1.15e1	SMART
WD40	1236	1273	2.84e2	SMART
Pfam:Rav1p_C	1430	1903	1.5e-71	PFAM
low complexity region	1978	1993	N/A	INTRINSIC
coiled coil region	2118	2146	N/A	INTRINSIC
low complexity region	2189	2204	N/A	INTRINSIC
low complexity region	2251	2266	N/A	INTRINSIC
low complexity region	2472	2490	N/A	INTRINSIC
low complexity region	2635	2649	N/A	INTRINSIC
low complexity region	2744	2766	N/A	INTRINSIC
WD40	2774	2809	5.73e0	SMART
WD40	2813	2852	8.88e0	SMART
WD40	2859	2901	2.67e-1	SMART
WD40	2907	2946	2.57e-2	SMART
WD40	2949	2988	3.61e-6	SMART
WD40	3001	3039	8.25e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000118600

SMART Domains

Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268

Domain	Start	End	E-Value	Type
WD40	43	84	4.58e1	SMART
WD40	100	136	2.28e2	SMART
WD40	159	198	2.57e-2	SMART
WD40	221	269	1.03e-1	SMART
low complexity region	420	440	N/A	INTRINSIC
WD40	741	793	1.42e2	SMART
low complexity region	861	875	N/A	INTRINSIC
low complexity region	945	961	N/A	INTRINSIC
WD40	985	1029	1.15e1	SMART
WD40	1236	1273	2.84e2	SMART
low complexity region	1426	1436	N/A	INTRINSIC
Pfam:Rav1p_C	1447	1903	4.2e-68	PFAM
low complexity region	1978	1993	N/A	INTRINSIC
coiled coil region	2118	2146	N/A	INTRINSIC
low complexity region	2189	2204	N/A	INTRINSIC
low complexity region	2251	2266	N/A	INTRINSIC
low complexity region	2471	2489	N/A	INTRINSIC
low complexity region	2722	2744	N/A	INTRINSIC
WD40	2752	2787	5.73e0	SMART
WD40	2791	2830	8.88e0	SMART
WD40	2837	2879	2.67e-1	SMART
WD40	2885	2924	2.57e-2	SMART
WD40	2927	2966	3.61e-6	SMART
WD40	2979	3017	8.25e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000123709

SMART Domains

Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
low complexity region	147	163	N/A	INTRINSIC
WD40	187	231	1.15e1	SMART
WD40	438	475	2.84e2	SMART
Pfam:Rav1p_C	632	1105	9.1e-72	PFAM
low complexity region	1180	1195	N/A	INTRINSIC
coiled coil region	1319	1347	N/A	INTRINSIC
low complexity region	1391	1406	N/A	INTRINSIC
low complexity region	1453	1468	N/A	INTRINSIC
low complexity region	1674	1692	N/A	INTRINSIC
low complexity region	1925	1947	N/A	INTRINSIC
WD40	1955	1990	5.73e0	SMART
WD40	1994	2033	8.88e0	SMART
WD40	2040	2082	2.67e-1	SMART
WD40	2088	2127	2.57e-2	SMART
WD40	2130	2169	3.61e-6	SMART
WD40	2182	2220	8.25e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127880

SMART Domains

Protein: ENSMUSP00000122293
Gene: ENSMUSG00000041268

Domain	Start	End	E-Value	Type
Pfam:WD40	1	24	7.9e-4	PFAM
WD40	47	95	1.03e-1	SMART
low complexity region	246	266	N/A	INTRINSIC
WD40	567	619	1.42e2	SMART
low complexity region	687	701	N/A	INTRINSIC
low complexity region	771	787	N/A	INTRINSIC
WD40	811	855	1.15e1	SMART
WD40	1062	1099	2.84e2	SMART
low complexity region	1252	1262	N/A	INTRINSIC

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.4%

Validation Efficiency

98% (87/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
Abcg1	T	A	17: 31,114,158	I625N	possibly damaging	Het
Adam33	C	A	2: 131,051,471		probably benign	Het
Adgrl2	A	T	3: 148,822,981	I1185N	probably damaging	Het
Afp	A	T	5: 90,501,627		probably benign	Het
Aggf1	A	G	13: 95,364,848	V342A	probably benign	Het
Ankrd11	A	T	8: 122,893,050	S1333R	probably benign	Het
Arhgef11	C	A	3: 87,733,469	S1311*	probably null	Het
Atp6v1g1	T	C	4: 63,548,641	Y47H	probably benign	Het
Atp8b4	T	C	2: 126,323,093		probably null	Het
Barx2	A	G	9: 31,859,031	L67P	probably damaging	Het
Bbs7	G	A	3: 36,573,557	P694S	probably benign	Het
Btbd10	A	T	7: 113,347,059	V33E	probably benign	Het
C2	T	C	17: 34,872,481	T69A	possibly damaging	Het
C8b	T	G	4: 104,784,482	L205R	possibly damaging	Het
Cct4	T	G	11: 22,994,333	N72K	probably damaging	Het
Cd300lg	C	A	11: 102,054,155	P353H	possibly damaging	Het
Cdh20	A	T	1: 104,947,497	I335L	possibly damaging	Het
Cfhr2	T	A	1: 139,811,019	H268L	probably benign	Het
Chia1	T	A	3: 106,128,939	D278E	probably benign	Het
Cntn6	A	G	6: 104,804,398	T482A	possibly damaging	Het
Cst13	T	A	2: 148,823,096	F4I	probably benign	Het
Ctsc	T	A	7: 88,281,498	V95E	probably damaging	Het
Ddhd1	A	T	14: 45,605,051		probably null	Het
Dnah5	A	C	15: 28,401,913	T3407P	probably damaging	Het
Dock1	T	A	7: 135,133,936	Y1344*	probably null	Het
Eif4g3	T	C	4: 138,206,084	V1740A	probably damaging	Het
Epb41l5	A	G	1: 119,578,904		probably benign	Het
Fam159b	A	T	13: 104,863,605	C37S	probably damaging	Het
Flt4	C	T	11: 49,636,339		probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Gm12790	A	G	4: 101,968,199	L6P	probably benign	Het
Gramd4	A	G	15: 86,125,196	D210G	probably damaging	Het
Hectd3	T	C	4: 117,002,269	S697P	possibly damaging	Het
Hsf4	T	C	8: 105,275,603	V399A	probably benign	Het
Hyal6	T	A	6: 24,743,435	C377S	probably damaging	Het
Myb	C	T	10: 21,152,945	V85M	probably damaging	Het
Mypn	A	G	10: 63,152,857	V463A	probably damaging	Het
Nav1	T	A	1: 135,460,425	I1144L	probably benign	Het
Nckap5	A	G	1: 126,014,661		probably benign	Het
Nipbl	A	T	15: 8,372,173	S30T	probably damaging	Het
Nmt1	T	C	11: 103,057,481	F277S	probably damaging	Het
Nploc4	A	C	11: 120,383,289		probably benign	Het
Nup54	C	A	5: 92,428,221	R137I	probably damaging	Het
Olfr667	T	C	7: 104,916,756	Y180C	probably damaging	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pkd1l1	G	T	11: 8,854,487	Y1701*	probably null	Het
Plekhg6	T	C	6: 125,363,109	T763A	probably damaging	Het
Pmepa1	C	T	2: 173,228,575		probably null	Het
Ppfia2	A	G	10: 106,830,657	E408G	possibly damaging	Het
Pramef12	G	A	4: 144,395,088	T122M	probably benign	Het
Prl8a2	G	A	13: 27,353,996	V218I	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
RP23-114B10.6	T	C	8: 69,373,370		noncoding transcript	Het
Slc13a1	A	T	6: 24,118,083		probably null	Het
Slc17a8	T	A	10: 89,591,214	T342S	probably damaging	Het
Slc30a9	A	G	5: 67,352,662	E519G	probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc39a5	G	A	10: 128,397,741	L296F	probably damaging	Het
Slco6b1	A	C	1: 96,929,885		noncoding transcript	Het
Slco6d1	G	A	1: 98,490,616	G509D	probably damaging	Het
Spen	A	G	4: 141,471,821	V3142A	probably damaging	Het
Spta1	T	A	1: 174,222,684	H1763Q	probably damaging	Het
Srcap	T	C	7: 127,559,952		probably benign	Het
Stard9	T	C	2: 120,712,847		probably benign	Het
Stat4	A	G	1: 52,071,947		probably benign	Het
Svbp	T	A	4: 119,196,028		probably benign	Het
Tm2d1	A	T	4: 98,370,596		probably benign	Het
Trpv1	C	A	11: 73,240,126		probably null	Het
Trrap	A	G	5: 144,857,422	D3713G	possibly damaging	Het
Ubr1	T	A	2: 120,955,644	D165V	probably benign	Het
Utrn	C	A	10: 12,649,153	M2195I	probably benign	Het
Vmn1r229	G	A	17: 20,814,642	V50I	possibly damaging	Het
Vmn1r44	A	T	6: 89,893,650	H126L	probably benign	Het
Vmn2r116	T	C	17: 23,386,596		probably benign	Het
Vmn2r27	A	C	6: 124,191,632	Y846*	probably null	Het
Vmn2r84	T	A	10: 130,391,990	S126C	possibly damaging	Het
Xylb	T	A	9: 119,368,067		probably benign	Het
Zfp282	A	T	6: 47,890,174	K232*	probably null	Het
Zfp39	C	A	11: 58,890,323	V538L	probably benign	Het
Zfp560	T	C	9: 20,351,853	N76D	possibly damaging	Het
Zmym4	C	T	4: 126,911,169	V433I	probably benign	Het
Zscan5b	A	G	7: 6,230,426	E83G	probably damaging	Het

Other mutations in Dmxl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dmxl2	APN	9	54401704	missense	probably benign
IGL00226:Dmxl2	APN	9	54415993	missense	probably damaging	1.00
IGL00419:Dmxl2	APN	9	54406667	missense	probably damaging	0.96
IGL00551:Dmxl2	APN	9	54450838	missense	probably damaging	1.00
IGL00765:Dmxl2	APN	9	54415422	unclassified	probably benign
IGL00852:Dmxl2	APN	9	54423313	nonsense	probably null
IGL00857:Dmxl2	APN	9	54376320	missense	probably benign	0.32
IGL00952:Dmxl2	APN	9	54416882	missense	probably damaging	0.99
IGL01139:Dmxl2	APN	9	54458964	missense	probably damaging	1.00
IGL01346:Dmxl2	APN	9	54415475	missense	probably damaging	1.00
IGL01538:Dmxl2	APN	9	54445376	splice site	probably benign
IGL01645:Dmxl2	APN	9	54378733	missense	possibly damaging	0.93
IGL02096:Dmxl2	APN	9	54401065	missense	possibly damaging	0.89
IGL02104:Dmxl2	APN	9	54404015	nonsense	probably null
IGL02145:Dmxl2	APN	9	54374697	missense	probably benign	0.29
IGL02210:Dmxl2	APN	9	54404049	missense	probably damaging	1.00
IGL02238:Dmxl2	APN	9	54445433	missense	probably damaging	1.00
IGL02255:Dmxl2	APN	9	54393768	missense	probably benign	0.06
IGL02364:Dmxl2	APN	9	54393843	missense	probably benign	0.02
IGL02423:Dmxl2	APN	9	54393748	missense	possibly damaging	0.89
IGL02440:Dmxl2	APN	9	54406615	missense	probably damaging	0.98
IGL02546:Dmxl2	APN	9	54366414	utr 3 prime	probably benign
IGL02668:Dmxl2	APN	9	54416945	missense	probably damaging	1.00
IGL03229:Dmxl2	APN	9	54404172	missense	probably damaging	1.00
IGL03244:Dmxl2	APN	9	54416371	missense	probably damaging	1.00
IGL03277:Dmxl2	APN	9	54404220	missense	probably damaging	1.00
IGL03399:Dmxl2	APN	9	54446672	missense	probably damaging	1.00
BB003:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
BB013:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
I2288:Dmxl2	UTSW	9	54401793	missense	probably damaging	1.00
P0014:Dmxl2	UTSW	9	54401764	missense	probably damaging	1.00
R0411:Dmxl2	UTSW	9	54378939	missense	probably damaging	1.00
R0422:Dmxl2	UTSW	9	54399940	critical splice donor site	probably null
R0432:Dmxl2	UTSW	9	54416951	missense	probably benign	0.01
R0436:Dmxl2	UTSW	9	54383750	missense	probably damaging	1.00
R0538:Dmxl2	UTSW	9	54393836	missense	probably benign	0.06
R0603:Dmxl2	UTSW	9	54405906	missense	possibly damaging	0.95
R0605:Dmxl2	UTSW	9	54419945	missense	probably benign	0.01
R0625:Dmxl2	UTSW	9	54382702	missense	probably benign
R0626:Dmxl2	UTSW	9	54416554	missense	probably damaging	1.00
R0736:Dmxl2	UTSW	9	54378817	missense	probably damaging	0.99
R0847:Dmxl2	UTSW	9	54405828	missense	probably damaging	1.00
R0855:Dmxl2	UTSW	9	54366440	missense	probably benign	0.03
R0962:Dmxl2	UTSW	9	54446412	missense	probably damaging	0.99
R1015:Dmxl2	UTSW	9	54367765	missense	probably benign	0.32
R1084:Dmxl2	UTSW	9	54416433	missense	probably damaging	1.00
R1328:Dmxl2	UTSW	9	54396249	missense	probably benign	0.12
R1503:Dmxl2	UTSW	9	54446988	nonsense	probably null
R1609:Dmxl2	UTSW	9	54409263	missense	possibly damaging	0.90
R1613:Dmxl2	UTSW	9	54382027	missense	probably benign
R1660:Dmxl2	UTSW	9	54451030	missense	possibly damaging	0.68
R1712:Dmxl2	UTSW	9	54401485	missense	probably benign	0.00
R1772:Dmxl2	UTSW	9	54423224	splice site	probably benign
R1832:Dmxl2	UTSW	9	54460949	missense	probably damaging	0.97
R1922:Dmxl2	UTSW	9	54401523	missense	probably benign
R2104:Dmxl2	UTSW	9	54415564	missense	probably damaging	1.00
R2109:Dmxl2	UTSW	9	54393813	missense	probably benign	0.06
R2145:Dmxl2	UTSW	9	54415910	missense	probably damaging	1.00
R2199:Dmxl2	UTSW	9	54376243	missense	probably benign	0.35
R2352:Dmxl2	UTSW	9	54393862	missense	probably damaging	1.00
R2516:Dmxl2	UTSW	9	54400094	missense	probably damaging	1.00
R2981:Dmxl2	UTSW	9	54393702	missense	probably damaging	1.00
R3430:Dmxl2	UTSW	9	54477461	missense	possibly damaging	0.94
R3625:Dmxl2	UTSW	9	54393643	missense	probably benign	0.23
R3725:Dmxl2	UTSW	9	54393769	missense	probably damaging	1.00
R3787:Dmxl2	UTSW	9	54369878	missense	probably damaging	1.00
R4002:Dmxl2	UTSW	9	54473832	splice site	probably benign
R4004:Dmxl2	UTSW	9	54446390	missense	probably benign	0.04
R4005:Dmxl2	UTSW	9	54446390	missense	probably benign	0.04
R4012:Dmxl2	UTSW	9	54379013	splice site	probably null
R4014:Dmxl2	UTSW	9	54378709	splice site	probably null
R4115:Dmxl2	UTSW	9	54446988	nonsense	probably null
R4232:Dmxl2	UTSW	9	54419909	missense	possibly damaging	0.89
R4388:Dmxl2	UTSW	9	54396267	missense	probably damaging	1.00
R4513:Dmxl2	UTSW	9	54419884	missense	probably null	0.17
R4552:Dmxl2	UTSW	9	54451763	missense	probably damaging	1.00
R4609:Dmxl2	UTSW	9	54446512	missense	probably damaging	1.00
R4625:Dmxl2	UTSW	9	54404120	missense	possibly damaging	0.55
R4694:Dmxl2	UTSW	9	54446905	missense	probably benign	0.04
R4711:Dmxl2	UTSW	9	54450924	missense	probably benign	0.37
R4715:Dmxl2	UTSW	9	54446405	splice site	probably null
R4746:Dmxl2	UTSW	9	54451796	missense	probably benign	0.04
R4789:Dmxl2	UTSW	9	54379815	missense	probably benign	0.30
R4825:Dmxl2	UTSW	9	54404041	missense	probably benign	0.01
R4911:Dmxl2	UTSW	9	54411653	missense	probably damaging	1.00
R4995:Dmxl2	UTSW	9	54501441	utr 5 prime	probably benign
R5026:Dmxl2	UTSW	9	54416676	missense	probably damaging	1.00
R5118:Dmxl2	UTSW	9	54460987	missense	probably damaging	1.00
R5174:Dmxl2	UTSW	9	54445484	splice site	probably null
R5288:Dmxl2	UTSW	9	54378757	missense	probably benign
R5373:Dmxl2	UTSW	9	54369189	intron	probably benign
R5374:Dmxl2	UTSW	9	54369189	intron	probably benign
R5385:Dmxl2	UTSW	9	54378757	missense	probably benign
R5386:Dmxl2	UTSW	9	54378757	missense	probably benign
R5418:Dmxl2	UTSW	9	54374651	critical splice donor site	probably null
R5540:Dmxl2	UTSW	9	54393857	missense	probably benign	0.21
R5568:Dmxl2	UTSW	9	54423359	splice site	probably null
R5733:Dmxl2	UTSW	9	54376266	missense	possibly damaging	0.64
R5758:Dmxl2	UTSW	9	54472964	missense	probably benign	0.28
R5759:Dmxl2	UTSW	9	54375508	missense	probably damaging	1.00
R5893:Dmxl2	UTSW	9	54387420	missense	possibly damaging	0.64
R6030:Dmxl2	UTSW	9	54393673	missense	probably benign	0.18
R6030:Dmxl2	UTSW	9	54393673	missense	probably benign	0.18
R6041:Dmxl2	UTSW	9	54416753	missense	probably damaging	1.00
R6174:Dmxl2	UTSW	9	54393727	missense	probably damaging	1.00
R6278:Dmxl2	UTSW	9	54415762	missense	probably damaging	1.00
R6307:Dmxl2	UTSW	9	54382706	missense	possibly damaging	0.68
R6349:Dmxl2	UTSW	9	54419909	missense	possibly damaging	0.89
R6404:Dmxl2	UTSW	9	54375536	missense	probably damaging	1.00
R6516:Dmxl2	UTSW	9	54416676	missense	probably damaging	1.00
R6712:Dmxl2	UTSW	9	54411624	missense	probably damaging	1.00
R6747:Dmxl2	UTSW	9	54416088	missense	probably damaging	1.00
R6769:Dmxl2	UTSW	9	54416524	missense	probably damaging	1.00
R6771:Dmxl2	UTSW	9	54416524	missense	probably damaging	1.00
R6800:Dmxl2	UTSW	9	54409183	missense	probably damaging	1.00
R6891:Dmxl2	UTSW	9	54480380	missense	probably damaging	0.99
R6920:Dmxl2	UTSW	9	54472212	missense	probably damaging	1.00
R6979:Dmxl2	UTSW	9	54450879	missense	possibly damaging	0.49
R7147:Dmxl2	UTSW	9	54416729	missense	probably benign	0.06
R7327:Dmxl2	UTSW	9	54401585	missense	probably damaging	1.00
R7462:Dmxl2	UTSW	9	54366632	splice site	probably null
R7526:Dmxl2	UTSW	9	54400957	missense	possibly damaging	0.47
R7569:Dmxl2	UTSW	9	54415987	missense	possibly damaging	0.51
R7622:Dmxl2	UTSW	9	54472218	missense	probably damaging	0.99
R7638:Dmxl2	UTSW	9	54457794	missense	unknown
R7703:Dmxl2	UTSW	9	54461086	missense	probably benign	0.01
R7768:Dmxl2	UTSW	9	54380939	missense	probably damaging	1.00
R7926:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
R7969:Dmxl2	UTSW	9	54446881	missense	possibly damaging	0.85
R8007:Dmxl2	UTSW	9	54383691	nonsense	probably null
R8200:Dmxl2	UTSW	9	54480346	missense	probably benign
R8311:Dmxl2	UTSW	9	54446933	missense	probably benign	0.00
R8320:Dmxl2	UTSW	9	54383759	missense	probably benign
R8377:Dmxl2	UTSW	9	54378748	missense	probably damaging	1.00
R8400:Dmxl2	UTSW	9	54383753	missense	probably benign	0.03
R8509:Dmxl2	UTSW	9	54428057	nonsense	probably null
R8698:Dmxl2	UTSW	9	54374669	missense	probably benign	0.10
R8768:Dmxl2	UTSW	9	54393821	missense	possibly damaging	0.83
R8770:Dmxl2	UTSW	9	54404014	missense	probably benign	0.01
R8799:Dmxl2	UTSW	9	54419743	critical splice donor site	probably null
R8840:Dmxl2	UTSW	9	54401855	missense	possibly damaging	0.58
R8898:Dmxl2	UTSW	9	54401657	missense	probably benign	0.01
R8954:Dmxl2	UTSW	9	54473872	missense	probably benign	0.04
R9083:Dmxl2	UTSW	9	54409264	missense	probably benign	0.29
R9114:Dmxl2	UTSW	9	54400037	missense
R9115:Dmxl2	UTSW	9	54401727	missense	probably benign
R9263:Dmxl2	UTSW	9	54451661	missense	probably benign	0.01
R9272:Dmxl2	UTSW	9	54404120	missense	possibly damaging	0.55
R9577:Dmxl2	UTSW	9	54416380	missense	unknown
R9673:Dmxl2	UTSW	9	54387556	missense	probably damaging	1.00
R9722:Dmxl2	UTSW	9	54416608	missense	probably benign	0.00
R9726:Dmxl2	UTSW	9	54415712	missense	probably benign	0.09
R9797:Dmxl2	UTSW	9	54450903	missense	probably benign	0.00
X0064:Dmxl2	UTSW	9	54401713	missense	probably benign
Z1177:Dmxl2	UTSW	9	54382034	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGCTCAGTGAGAATTCACAGACATC -3'
(R):5'- AACCTGTCACAGTATGGACCAGCC -3'

Sequencing Primer
(F):5'- GACATCACAAATCTGTATGCCG -3'
(R):5'- CAGTATGGACCAGCCTGTTTTG -3'

Posted On

2014-03-14