Incidental Mutation 'R1401:C2'
ID 160167
Institutional Source Beutler Lab
Gene Symbol C2
Ensembl Gene ENSMUSG00000024371
Gene Name complement component 2 (within H-2S)
Synonyms classical-complement pathway C3/C5 convertase
MMRRC Submission 039463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock # R1401 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34862604-34898265 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34872481 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 69 (T69A)
Ref Sequence ENSEMBL: ENSMUSP00000120009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025230] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000152417]
AlphaFold P21180
Predicted Effect possibly damaging
Transcript: ENSMUST00000025230
AA Change: T346A

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371
AA Change: T346A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129891
AA Change: T9A
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511
AA Change: T9A

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130728
Predicted Effect unknown
Transcript: ENSMUST00000146299
AA Change: T193A
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511
AA Change: T193A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148431
AA Change: T69A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371
AA Change: T69A

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152417
AA Change: T209A

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371
AA Change: T209A

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Meta Mutation Damage Score 0.3536 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: This gene encodes component C2 of the classical pathway of the complement system. The encoded protein undergoes proteolytic processing mediated by component C1 resulting in C2a and C2b fragments. C2a fragment, in turn, selectively cleaves components C3 and C5 of the complement system. Mice lacking the encoded protein are found to be more susceptible to bacterial infections. Mutations in the human homolog of this gene are associated with disorders such as systemic lupus erythematosus, Henoch-Schonlein purpura, or polymyositis. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abcg1 T A 17: 31,114,158 I625N possibly damaging Het
Adam33 C A 2: 131,051,471 probably benign Het
Adgrl2 A T 3: 148,822,981 I1185N probably damaging Het
Afp A T 5: 90,501,627 probably benign Het
Aggf1 A G 13: 95,364,848 V342A probably benign Het
Ankrd11 A T 8: 122,893,050 S1333R probably benign Het
Arhgef11 C A 3: 87,733,469 S1311* probably null Het
Atp6v1g1 T C 4: 63,548,641 Y47H probably benign Het
Atp8b4 T C 2: 126,323,093 probably null Het
Barx2 A G 9: 31,859,031 L67P probably damaging Het
Bbs7 G A 3: 36,573,557 P694S probably benign Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
C8b T G 4: 104,784,482 L205R possibly damaging Het
Cct4 T G 11: 22,994,333 N72K probably damaging Het
Cd300lg C A 11: 102,054,155 P353H possibly damaging Het
Cdh20 A T 1: 104,947,497 I335L possibly damaging Het
Cfhr2 T A 1: 139,811,019 H268L probably benign Het
Chia1 T A 3: 106,128,939 D278E probably benign Het
Cntn6 A G 6: 104,804,398 T482A possibly damaging Het
Cst13 T A 2: 148,823,096 F4I probably benign Het
Ctsc T A 7: 88,281,498 V95E probably damaging Het
Ddhd1 A T 14: 45,605,051 probably null Het
Dmxl2 A T 9: 54,415,428 probably null Het
Dnah5 A C 15: 28,401,913 T3407P probably damaging Het
Dock1 T A 7: 135,133,936 Y1344* probably null Het
Eif4g3 T C 4: 138,206,084 V1740A probably damaging Het
Epb41l5 A G 1: 119,578,904 probably benign Het
Fam159b A T 13: 104,863,605 C37S probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Gm12790 A G 4: 101,968,199 L6P probably benign Het
Gramd4 A G 15: 86,125,196 D210G probably damaging Het
Hectd3 T C 4: 117,002,269 S697P possibly damaging Het
Hsf4 T C 8: 105,275,603 V399A probably benign Het
Hyal6 T A 6: 24,743,435 C377S probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Mypn A G 10: 63,152,857 V463A probably damaging Het
Nav1 T A 1: 135,460,425 I1144L probably benign Het
Nckap5 A G 1: 126,014,661 probably benign Het
Nipbl A T 15: 8,372,173 S30T probably damaging Het
Nmt1 T C 11: 103,057,481 F277S probably damaging Het
Nploc4 A C 11: 120,383,289 probably benign Het
Nup54 C A 5: 92,428,221 R137I probably damaging Het
Olfr667 T C 7: 104,916,756 Y180C probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pkd1l1 G T 11: 8,854,487 Y1701* probably null Het
Plekhg6 T C 6: 125,363,109 T763A probably damaging Het
Pmepa1 C T 2: 173,228,575 probably null Het
Ppfia2 A G 10: 106,830,657 E408G possibly damaging Het
Pramef12 G A 4: 144,395,088 T122M probably benign Het
Prl8a2 G A 13: 27,353,996 V218I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
RP23-114B10.6 T C 8: 69,373,370 noncoding transcript Het
Slc13a1 A T 6: 24,118,083 probably null Het
Slc17a8 T A 10: 89,591,214 T342S probably damaging Het
Slc30a9 A G 5: 67,352,662 E519G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc39a5 G A 10: 128,397,741 L296F probably damaging Het
Slco6b1 A C 1: 96,929,885 noncoding transcript Het
Slco6d1 G A 1: 98,490,616 G509D probably damaging Het
Spen A G 4: 141,471,821 V3142A probably damaging Het
Spta1 T A 1: 174,222,684 H1763Q probably damaging Het
Srcap T C 7: 127,559,952 probably benign Het
Stard9 T C 2: 120,712,847 probably benign Het
Stat4 A G 1: 52,071,947 probably benign Het
Svbp T A 4: 119,196,028 probably benign Het
Tm2d1 A T 4: 98,370,596 probably benign Het
Trpv1 C A 11: 73,240,126 probably null Het
Trrap A G 5: 144,857,422 D3713G possibly damaging Het
Ubr1 T A 2: 120,955,644 D165V probably benign Het
Utrn C A 10: 12,649,153 M2195I probably benign Het
Vmn1r229 G A 17: 20,814,642 V50I possibly damaging Het
Vmn1r44 A T 6: 89,893,650 H126L probably benign Het
Vmn2r116 T C 17: 23,386,596 probably benign Het
Vmn2r27 A C 6: 124,191,632 Y846* probably null Het
Vmn2r84 T A 10: 130,391,990 S126C possibly damaging Het
Xylb T A 9: 119,368,067 probably benign Het
Zfp282 A T 6: 47,890,174 K232* probably null Het
Zfp39 C A 11: 58,890,323 V538L probably benign Het
Zfp560 T C 9: 20,351,853 N76D possibly damaging Het
Zmym4 C T 4: 126,911,169 V433I probably benign Het
Zscan5b A G 7: 6,230,426 E83G probably damaging Het
Other mutations in C2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:C2 APN 17 34866563 missense probably damaging 1.00
IGL02249:C2 APN 17 34864508 unclassified probably benign
IGL02568:C2 APN 17 34864349 missense possibly damaging 0.50
IGL03013:C2 APN 17 34872459 missense probably damaging 0.98
R0142:C2 UTSW 17 34873528 missense possibly damaging 0.53
R0619:C2 UTSW 17 34872503 missense probably damaging 1.00
R1639:C2 UTSW 17 34872403 missense probably benign 0.02
R1808:C2 UTSW 17 34864532 missense probably damaging 1.00
R2133:C2 UTSW 17 34879902 missense probably damaging 1.00
R2860:C2 UTSW 17 34863878 missense possibly damaging 0.94
R2861:C2 UTSW 17 34863878 missense possibly damaging 0.94
R3882:C2 UTSW 17 34873489 missense probably benign 0.00
R4571:C2 UTSW 17 34863659 missense probably benign 0.00
R4622:C2 UTSW 17 34863674 missense probably damaging 0.99
R5611:C2 UTSW 17 34872384 missense probably damaging 0.99
R5767:C2 UTSW 17 34876456 missense possibly damaging 0.58
R6327:C2 UTSW 17 34864103 missense probably benign 0.41
R6448:C2 UTSW 17 34863359 missense possibly damaging 0.67
R6518:C2 UTSW 17 34864118 missense probably damaging 1.00
R6929:C2 UTSW 17 34864347 missense possibly damaging 0.68
R7324:C2 UTSW 17 34881688 missense probably benign 0.13
R7446:C2 UTSW 17 34876010 missense probably damaging 1.00
R7456:C2 UTSW 17 34864582 missense probably damaging 1.00
R7479:C2 UTSW 17 34863465 missense probably damaging 1.00
R7807:C2 UTSW 17 34876371 missense possibly damaging 0.79
R7943:C2 UTSW 17 34872378 missense probably damaging 1.00
R9235:C2 UTSW 17 34864869 missense probably damaging 1.00
R9397:C2 UTSW 17 34875989 missense probably damaging 1.00
R9452:C2 UTSW 17 34876343 missense probably benign 0.01
R9605:C2 UTSW 17 34862982 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCAGAACCTATCCTGGCACTCTGC -3'
(R):5'- AGGTCCACGTTCAAATGCACCTG -3'

Sequencing Primer
(F):5'- GGCACTCTGCCACTGTTG -3'
(R):5'- atcctcctgcctctgcc -3'
Posted On 2014-03-14