Mutagenetix > Incidental Mutation

Incidental Mutation 'R1397:Sned1'

160170

Institutional Source

Beutler Lab

Gene Symbol

Sned1

Ensembl Gene

ENSMUSG00000047793

Gene Name

sushi, nidogen and EGF-like domains 1

Synonyms

6720455I24Rik, D430044C15Rik, Snep

MMRRC Submission

039459-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R1397 (G1)

Quality Score

176

Status

Validated

Chromosome

Chromosomal Location

93235841-93301065 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 93281654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 830 (V830M)

Ref Sequence

ENSEMBL: ENSMUSP00000050832 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062202]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062202
AA Change: V830M

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: V830M

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
NIDO	103	260	2.98e-54	SMART
EGF	271	309	3.79e-6	SMART
EGF_CA	311	347	2.42e-13	SMART
EGF	352	385	1.02e-6	SMART
EGF_CA	387	423	1.91e-11	SMART
EGF	432	465	2.96e-8	SMART
EGF	471	500	6.02e0	SMART
EGF	544	577	3.54e-6	SMART
EGF	583	616	6.06e-5	SMART
EGF_CA	619	655	2.33e-6	SMART
EGF	660	693	1.77e-6	SMART
CCP	698	751	2.5e-11	SMART
EGF_CA	753	789	1.66e-11	SMART
EGF_CA	791	827	1.38e-8	SMART
EGF_CA	829	865	1.92e-7	SMART
EGF	870	903	2.35e-2	SMART
FN3	906	991	1.7e-4	SMART
FN3	1005	1084	1.38e-4	SMART
FN3	1104	1185	1.6e-9	SMART
EGF	1309	1342	6.16e-6	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000163688
AA Change: V39M

SMART Domains

Protein: ENSMUSP00000132455
Gene: ENSMUSG00000047793
AA Change: V39M

Domain	Start	End	E-Value	Type
EGF_CA	1	37	6.7e-7	SMART
EGF_CA	39	75	1.92e-7	SMART
EGF	80	113	2.35e-2	SMART
FN3	116	201	1.7e-4	SMART
FN3	215	294	1.38e-4	SMART
FN3	314	395	1.6e-9	SMART
EGF	487	520	6.16e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165843

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172289

Meta Mutation Damage Score

0.1152

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.6%
20x: 87.0%

Validation Efficiency

98% (59/60)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	T	C	17: 24,285,759	E1222G	probably benign	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
Ankmy2	T	C	12: 36,170,441		probably benign	Het
Arhgef10l	C	T	4: 140,544,443	G827D	probably damaging	Het
Chrac1	A	G	15: 73,090,444	D3G	possibly damaging	Het
Dmrtb1	G	C	4: 107,677,039	P349R	probably damaging	Het
Drd1	A	G	13: 54,053,554	Y207H	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Epb41l3	T	A	17: 69,262,348		probably null	Het
Fam13b	C	T	18: 34,445,583	M705I	probably benign	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Iqgap2	A	G	13: 95,632,165	I1409T	probably benign	Het
Itih1	C	T	14: 30,929,905		probably benign	Het
Itih5	A	T	2: 10,240,807	D569V	probably benign	Het
Krt9	A	T	11: 100,192,638	L189Q	probably damaging	Het
Mfsd11	T	C	11: 116,873,297	F368S	probably damaging	Het
Neb	C	A	2: 52,243,943	V3343F	probably damaging	Het
Nfe2l3	T	C	6: 51,433,294	S130P	probably benign	Het
Nid1	G	A	13: 13,508,795	A1153T	possibly damaging	Het
Nr2c2	T	C	6: 92,149,764	I78T	probably benign	Het
Nrp1	T	G	8: 128,418,716	Y84*	probably null	Het
Pate2	T	A	9: 35,669,695	F2I	probably damaging	Het
Pign	A	G	1: 105,657,771	S18P	probably damaging	Het
Pla2r1	T	A	2: 60,534,762	T155S	probably benign	Het
Rabl3	C	T	16: 37,539,974		probably benign	Het
Rhbg	C	T	3: 88,248,446	V66I	probably benign	Het
Rimkla	C	T	4: 119,468,111	G367E	probably benign	Het
Rnpepl1	C	A	1: 92,917,159	T391N	probably damaging	Het
Rnps1	C	T	17: 24,412,057		probably benign	Het
Rrs1	G	A	1: 9,545,767	E82K	probably damaging	Het
Slc25a48	A	C	13: 56,465,051	D254A	probably damaging	Het
Slc28a2	T	A	2: 122,460,531	C659*	probably null	Het
Spata31d1a	C	T	13: 59,705,039		probably benign	Het
Srrm1	A	C	4: 135,321,431		probably benign	Het
Srrt	A	G	5: 137,300,261	V247A	possibly damaging	Het
Tnks2	T	C	19: 36,880,501		probably benign	Het
Trim33	A	G	3: 103,310,434		probably benign	Het
Trim42	T	A	9: 97,365,621	I341F	probably damaging	Het
Trim55	T	C	3: 19,644,637	F10S	probably benign	Het
Trpm1	T	C	7: 64,217,658	W369R	probably damaging	Het
Vps13d	C	T	4: 145,141,334	R1976H	probably damaging	Het

Other mutations in Sned1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Sned1	APN	1	93274169	splice site	probably benign
IGL00955:Sned1	APN	1	93274403	missense	probably damaging	1.00
IGL01367:Sned1	APN	1	93283214	missense	probably benign	0.32
IGL02116:Sned1	APN	1	93281725	nonsense	probably null
IGL02195:Sned1	APN	1	93274160	missense	probably benign	0.03
IGL02390:Sned1	APN	1	93261664	missense	probably benign
IGL02423:Sned1	APN	1	93283600	missense	probably benign
IGL02451:Sned1	APN	1	93236208	splice site	probably benign
IGL02567:Sned1	APN	1	93274347	missense	probably damaging	0.96
IGL03184:Sned1	APN	1	93274668	missense	probably benign	0.01
IGL03328:Sned1	APN	1	93289367	missense	probably benign
Bulger	UTSW	1	93271663	nonsense	probably null
farina	UTSW	1	93281652	missense	probably damaging	1.00
Millet	UTSW	1	93281654	missense	possibly damaging	0.89
triticale	UTSW	1	93281654	missense
R0257:Sned1	UTSW	1	93265097	missense	possibly damaging	0.75
R0372:Sned1	UTSW	1	93285951	splice site	probably benign
R0525:Sned1	UTSW	1	93271974	splice site	probably null
R0727:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0759:Sned1	UTSW	1	93272564	missense	probably damaging	1.00
R0965:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0968:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0969:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1006:Sned1	UTSW	1	93256392	missense	probably damaging	1.00
R1068:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1069:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1070:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1112:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1113:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1114:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1115:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1118:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1119:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1144:Sned1	UTSW	1	93280576	missense	probably damaging	0.98
R1228:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1230:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1231:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1313:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1313:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1340:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1382:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1383:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1394:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1395:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1414:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1430:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1432:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1473:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1503:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1563:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1565:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1689:Sned1	UTSW	1	93283372	missense	probably damaging	0.99
R1695:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1734:Sned1	UTSW	1	93259768	missense	probably damaging	1.00
R1764:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1767:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1896:Sned1	UTSW	1	93265047	missense	probably benign	0.16
R1916:Sned1	UTSW	1	93274162	missense	probably null	1.00
R1945:Sned1	UTSW	1	93271238	missense	probably benign	0.01
R1972:Sned1	UTSW	1	93265073	missense	probably damaging	1.00
R1973:Sned1	UTSW	1	93265073	missense	probably damaging	1.00
R2143:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2144:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2145:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2153:Sned1	UTSW	1	93274657	missense	probably benign	0.01
R2273:Sned1	UTSW	1	93281642	splice site	probably null
R2274:Sned1	UTSW	1	93281642	splice site	probably null
R2275:Sned1	UTSW	1	93281642	splice site	probably null
R2340:Sned1	UTSW	1	93256452	missense	probably damaging	0.98
R3237:Sned1	UTSW	1	93259003	missense	probably benign	0.21
R3747:Sned1	UTSW	1	93261751	missense	probably damaging	1.00
R3879:Sned1	UTSW	1	93265030	splice site	probably benign
R4281:Sned1	UTSW	1	93285855	nonsense	probably null
R4282:Sned1	UTSW	1	93285855	nonsense	probably null
R4356:Sned1	UTSW	1	93265391	splice site	probably null
R4358:Sned1	UTSW	1	93274659	missense	probably benign	0.01
R4677:Sned1	UTSW	1	93296297	unclassified	probably benign
R5291:Sned1	UTSW	1	93295724	missense	possibly damaging	0.80
R5340:Sned1	UTSW	1	93282757	missense	probably benign	0.09
R5542:Sned1	UTSW	1	93271602	missense	probably benign
R5582:Sned1	UTSW	1	93282361	missense	probably damaging	1.00
R5874:Sned1	UTSW	1	93265345	missense	probably damaging	1.00
R6159:Sned1	UTSW	1	93282937	missense	probably benign	0.00
R6175:Sned1	UTSW	1	93275474	splice site	probably null
R6445:Sned1	UTSW	1	93283596	missense	possibly damaging	0.89
R6631:Sned1	UTSW	1	93281652	missense	probably damaging	1.00
R7018:Sned1	UTSW	1	93284421	missense	probably damaging	1.00
R7035:Sned1	UTSW	1	93262130	missense	probably damaging	1.00
R7047:Sned1	UTSW	1	93285818	missense	possibly damaging	0.51
R7347:Sned1	UTSW	1	93281736	missense	probably damaging	1.00
R7427:Sned1	UTSW	1	93289358	missense	probably benign	0.11
R7581:Sned1	UTSW	1	93256545	missense	probably benign	0.00
R7679:Sned1	UTSW	1	93236038	missense	unknown
R7899:Sned1	UTSW	1	93274082	missense	probably benign	0.04
R8093:Sned1	UTSW	1	93274665	missense	possibly damaging	0.82
R8124:Sned1	UTSW	1	93282989	critical splice donor site	probably null
R8489:Sned1	UTSW	1	93283256	nonsense	probably null
R9012:Sned1	UTSW	1	93284598	missense	probably damaging	0.99
R9290:Sned1	UTSW	1	93271663	nonsense	probably null
R9560:Sned1	UTSW	1	93274388	missense	probably damaging	1.00
R9775:Sned1	UTSW	1	93271882	missense	probably damaging	0.99
X0025:Sned1	UTSW	1	93261687	missense	probably damaging	1.00
Z1176:Sned1	UTSW	1	93259042	missense	probably damaging	1.00
Z1177:Sned1	UTSW	1	93285820	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCATCCTCTTGCTGGACAAGCTAC -3'
(R):5'- TCCTGAAAAGCCTGACCAAGTGTG -3'

Sequencing Primer
(F):5'- TTGCTGGACAAGCTACTCAGAG -3'
(R):5'- GCCTATCCAGGGACAACAGAG -3'

Posted On

2014-03-14