Incidental Mutation 'R1397:Nfe2l3'
ID160184
Institutional Source Beutler Lab
Gene Symbol Nfe2l3
Ensembl Gene ENSMUSG00000029832
Gene Namenuclear factor, erythroid derived 2, like 3
SynonymsNrf3
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1397 (G1)
Quality Score140
Status Validated
Chromosome6
Chromosomal Location51432670-51458768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51433294 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 130 (S130P)
Ref Sequence ENSEMBL: ENSMUSP00000124920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005103] [ENSMUST00000160133]
Predicted Effect probably benign
Transcript: ENSMUST00000005103
AA Change: S130P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005103
Gene: ENSMUSG00000029832
AA Change: S130P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
BRLZ 539 603 3.68e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000061507
Predicted Effect probably benign
Transcript: ENSMUST00000160133
AA Change: S130P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124920
Gene: ENSMUSG00000029832
AA Change: S130P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 145 155 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cap 'n' collar basic-region leucine zipper family of transcription factors. The encoded protein heterodimerizes with small musculoaponeurotic fibrosarcoma factors to bind antioxidant response elements in target genes. This protein is a membrane bound glycoprotein that is targeted to the endoplasmic reticulum and the nuclear envelope. Pseudogenes of this gene are found on chromosomes 16, 17, and 18. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Nfe2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02705:Nfe2l3 APN 6 51433118 missense probably damaging 0.96
IGL02803:Nfe2l3 APN 6 51457311 missense possibly damaging 0.50
R0277:Nfe2l3 UTSW 6 51457468 missense probably benign 0.30
R0693:Nfe2l3 UTSW 6 51433054 missense possibly damaging 0.94
R1455:Nfe2l3 UTSW 6 51457764 missense possibly damaging 0.91
R1541:Nfe2l3 UTSW 6 51457605 missense probably damaging 0.98
R1753:Nfe2l3 UTSW 6 51433412 missense probably null 0.96
R1946:Nfe2l3 UTSW 6 51457315 missense probably damaging 1.00
R2034:Nfe2l3 UTSW 6 51458370 missense possibly damaging 0.50
R3807:Nfe2l3 UTSW 6 51457377 nonsense probably null
R3932:Nfe2l3 UTSW 6 51456615 missense possibly damaging 0.94
R4271:Nfe2l3 UTSW 6 51456634 missense probably damaging 0.99
R4604:Nfe2l3 UTSW 6 51451012 missense probably damaging 0.99
R4816:Nfe2l3 UTSW 6 51456624 missense probably damaging 0.99
R5765:Nfe2l3 UTSW 6 51457246 missense probably damaging 1.00
R5893:Nfe2l3 UTSW 6 51457852 missense probably damaging 1.00
R7378:Nfe2l3 UTSW 6 51457296 nonsense probably null
R7490:Nfe2l3 UTSW 6 51457544 missense possibly damaging 0.65
R7624:Nfe2l3 UTSW 6 51458272 missense probably damaging 1.00
R8210:Nfe2l3 UTSW 6 51451085 missense probably benign 0.00
R8678:Nfe2l3 UTSW 6 51458173 missense possibly damaging 0.54
Z1177:Nfe2l3 UTSW 6 51433297 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGCAACTCACGATTCTGTTGAGC -3'
(R):5'- TTCATTCAAAAGGAGGCGGGGCAC -3'

Sequencing Primer
(F):5'- ACTTTGGGAAGAGCTGCTCC -3'
(R):5'- TAGTCATCGGGACCCTAGAG -3'
Posted On2014-03-14