Incidental Mutation 'R1397:Nid1'
ID160194
Institutional Source Beutler Lab
Gene Symbol Nid1
Ensembl Gene ENSMUSG00000005397
Gene Namenidogen 1
Synonymsentactin 1, nidogen-1, entactin, entactin-1
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R1397 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location13437551-13512269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13508795 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1153 (A1153T)
Ref Sequence ENSEMBL: ENSMUSP00000005532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005532]
PDB Structure NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005532
AA Change: A1153T

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397
AA Change: A1153T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
NIDO 106 270 3.8e-70 SMART
low complexity region 277 296 N/A INTRINSIC
EGF 387 424 3.46e0 SMART
G2F 425 664 7.69e-153 SMART
EGF 669 707 8.65e-1 SMART
EGF_CA 708 749 4.38e-11 SMART
EGF 759 799 8.19e-2 SMART
EGF_CA 800 838 1.42e-10 SMART
TY 873 921 1.17e-19 SMART
LY 968 1010 1.35e-2 SMART
LY 1011 1053 4.34e-15 SMART
LY 1054 1098 3.34e-16 SMART
LY 1099 1141 3.25e-5 SMART
LY 1142 1181 1.08e1 SMART
EGF 1209 1242 2.45e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222436
Meta Mutation Damage Score 0.3967 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Nid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Nid1 APN 13 13476392 missense probably damaging 1.00
IGL02126:Nid1 APN 13 13489158 splice site probably null
IGL02452:Nid1 APN 13 13508720 missense probably benign 0.17
IGL02806:Nid1 APN 13 13468312 missense probably benign 0.00
IGL02966:Nid1 APN 13 13482221 missense probably benign 0.09
IGL03136:Nid1 APN 13 13500499 missense probably benign 0.33
IGL03411:Nid1 APN 13 13437889 missense probably damaging 0.98
R0384:Nid1 UTSW 13 13463836 missense probably benign 0.34
R0413:Nid1 UTSW 13 13482096 missense probably benign 0.01
R1257:Nid1 UTSW 13 13483790 missense probably benign 0.01
R1390:Nid1 UTSW 13 13476246 missense probably damaging 1.00
R2057:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2058:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2059:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2132:Nid1 UTSW 13 13509486 missense probably benign 0.04
R2140:Nid1 UTSW 13 13499668 missense probably damaging 1.00
R2195:Nid1 UTSW 13 13476203 missense probably damaging 1.00
R2237:Nid1 UTSW 13 13500485 missense probably benign
R2312:Nid1 UTSW 13 13500493 missense probably benign 0.15
R2987:Nid1 UTSW 13 13499673 missense probably benign 0.40
R3696:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3697:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3698:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3772:Nid1 UTSW 13 13476418 splice site probably benign
R4092:Nid1 UTSW 13 13486639 missense probably damaging 0.96
R4126:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4128:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4680:Nid1 UTSW 13 13472852 missense probably damaging 1.00
R4717:Nid1 UTSW 13 13506501 missense probably benign 0.00
R4783:Nid1 UTSW 13 13499741 missense probably damaging 0.97
R4812:Nid1 UTSW 13 13506468 nonsense probably null
R4834:Nid1 UTSW 13 13508823 missense probably damaging 1.00
R4915:Nid1 UTSW 13 13499586 missense possibly damaging 0.89
R4930:Nid1 UTSW 13 13510011 missense probably damaging 1.00
R5101:Nid1 UTSW 13 13483754 missense probably damaging 1.00
R5276:Nid1 UTSW 13 13468572 missense probably damaging 0.99
R5427:Nid1 UTSW 13 13483683 missense probably damaging 1.00
R5447:Nid1 UTSW 13 13437910 missense probably benign 0.00
R5507:Nid1 UTSW 13 13489037 nonsense probably null
R5663:Nid1 UTSW 13 13472834 missense probably damaging 1.00
R5868:Nid1 UTSW 13 13489157 critical splice donor site probably null
R6313:Nid1 UTSW 13 13463782 missense probably benign 0.01
R6761:Nid1 UTSW 13 13482035 missense probably benign 0.22
R7069:Nid1 UTSW 13 13508768 missense probably benign
R7208:Nid1 UTSW 13 13468385 missense probably benign 0.01
R7284:Nid1 UTSW 13 13489090 missense probably benign 0.01
R7434:Nid1 UTSW 13 13468464 missense probably benign
R7449:Nid1 UTSW 13 13482051 missense probably damaging 1.00
R7574:Nid1 UTSW 13 13468443 missense probably benign
R7762:Nid1 UTSW 13 13489045 missense probably damaging 1.00
R7887:Nid1 UTSW 13 13499733 missense possibly damaging 0.83
R8420:Nid1 UTSW 13 13437831 missense possibly damaging 0.81
R8506:Nid1 UTSW 13 13476174 missense probably damaging 0.99
R8756:Nid1 UTSW 13 13508801 missense probably benign 0.32
R8903:Nid1 UTSW 13 13463930 missense probably benign 0.00
X0028:Nid1 UTSW 13 13509534 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGAACGCCAATGCTGAAGAGCC -3'
(R):5'- TCCTCCATATCTGACAGCCAGGAC -3'

Sequencing Primer
(F):5'- GGACATGCCATTGAAACACTG -3'
(R):5'- TATCTGACAGCCAGGACAAAGG -3'
Posted On2014-03-14