Incidental Mutation 'R1397:Fam13b'
ID 160206
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Name family with sequence similarity 13, member B
Synonyms 2610024E20Rik
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R1397 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 34442352-34506823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34445583 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 705 (M705I)
Ref Sequence ENSEMBL: ENSMUSP00000038199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014647] [ENSMUST00000040506] [ENSMUST00000166156]
AlphaFold Q8K2H3
Predicted Effect probably benign
Transcript: ENSMUST00000014647
SMART Domains Protein: ENSMUSP00000014647
Gene: ENSMUSG00000014503

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.8e-129 PFAM
Pfam:Ion_trans 281 490 4.1e-19 PFAM
coiled coil region 523 550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040506
AA Change: M705I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501
AA Change: M705I

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166156
SMART Domains Protein: ENSMUSP00000127257
Gene: ENSMUSG00000014503

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.6e-131 PFAM
Pfam:Ion_trans 242 502 4.8e-20 PFAM
coiled coil region 523 550 N/A INTRINSIC
Meta Mutation Damage Score 0.0955 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34487096 missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34454718 missense probably damaging 1.00
IGL00556:Fam13b APN 18 34497435 missense probably damaging 0.99
IGL02123:Fam13b APN 18 34445618 unclassified probably benign
IGL02313:Fam13b APN 18 34454656 missense probably damaging 1.00
IGL02346:Fam13b APN 18 34462105 missense probably benign 0.00
IGL02347:Fam13b APN 18 34454704 missense probably damaging 1.00
IGL02694:Fam13b APN 18 34451206 critical splice donor site probably null
IGL03347:Fam13b APN 18 34462051 splice site probably benign
R0109:Fam13b UTSW 18 34451308 missense probably benign 0.00
R0233:Fam13b UTSW 18 34448084 missense probably damaging 1.00
R0455:Fam13b UTSW 18 34445528 unclassified probably benign
R1229:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1571:Fam13b UTSW 18 34497432 missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34451439 critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34487134 missense probably benign 0.04
R1777:Fam13b UTSW 18 34457760 missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34445329 missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34494761 missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34462059 critical splice donor site probably null
R3896:Fam13b UTSW 18 34462955 splice site probably benign
R5277:Fam13b UTSW 18 34462190 missense probably benign
R5759:Fam13b UTSW 18 34497435 missense probably damaging 0.99
R5817:Fam13b UTSW 18 34457797 missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34454081 missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34497405 missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34494774 missense probably damaging 1.00
R6087:Fam13b UTSW 18 34487139 missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34494277 missense probably damaging 0.96
R6454:Fam13b UTSW 18 34457662 critical splice donor site probably null
R6464:Fam13b UTSW 18 34473631 nonsense probably null
R6679:Fam13b UTSW 18 34487022 missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34498026 missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34497447 missense possibly damaging 0.92
R7420:Fam13b UTSW 18 34494611 missense probably damaging 1.00
R7517:Fam13b UTSW 18 34494607 missense probably damaging 0.98
R7534:Fam13b UTSW 18 34498007 missense probably damaging 0.97
R7889:Fam13b UTSW 18 34457691 missense probably benign 0.00
R8139:Fam13b UTSW 18 34473633 missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8826:Fam13b UTSW 18 34498017 missense probably damaging 0.96
R9166:Fam13b UTSW 18 34462199 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCACGCATCCCTCTTGTCAGAGAAG -3'
(R):5'- TTTAGCTGCTGGGGACTAAGCGCC -3'

Sequencing Primer
(F):5'- TCCCTCTTGTCAGAGAAGCTAAG -3'
(R):5'- ACTAAGCGCCCTATTAGGTGG -3'
Posted On 2014-03-14